Animal Models for the Analysis of Immune Responses to Leishmaniasis

David L. Sacks1, Peter C. Melby2

1 National Institute of Allergy & Infectious Diseases, Bethesda, Maryland, 2 University of Texas Medical Branch (UTMB), Galveston, Texas
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 19.2
DOI:  10.1002/0471142735.im1902s108
Online Posting Date:  February, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit focuses on the murine model of cutaneous leishmaniasis and models of visceral leishmaniasis in mice and hamsters. Each basic protocol describes the methods used to inoculate parasites and to evaluate infections with regard to lesion progression and visceralization, and quantification of parasite load. © 2015 by John Wiley & Sons, Inc.

Keywords: leishmaniasis; animal models; sand fly; skin; liver; spleen

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Mouse Models of Cutaneous Leishmaniasis
  • Basic Protocol 2: Mouse and Hamster Models of Visceral Leishmaniasis
  • Support Protocol 1: Preparation of Metacyclic Promastigotes Using Peanut Agglutinin (PNA)
  • Support Protocol 2: Preparation of Metacyclic Promastigotes by Ficoll Density Gradient Centrifugation
  • Support Protocol 3: Purification of Tissue Amastigotes from Footpad or Spleen
  • Support Protocol 4: Cryopreservation and Thawing of Promastigotes and Amastigotes
  • Support Protocol 5: Preparation of Blood Agar Plates
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Mouse Models of Cutaneous Leishmaniasis

  Materials
  • Parasite inoculum, either amastigotes or metacyclic promastigotes (see Support Protocols protocol 31 to protocol 64)
  • Dulbecco's minimal essential medium (DMEM) or HBSS without CaCl 2 or MgCl 2 ( appendix 2A)
  • Mice (Table 19.2.1)
  • 20 mg/ml ketamine in normal saline (0.9% NaCl)
  • Complete medium 199 (C‐M199; see recipe)
  • 70% ethanol
  • 160 μg/ml Liberase TL purified enzyme blend (Roche Diagnostic Corp.)
  • Blood agar plates (see protocol 7)
  • Qiagen DNeasy Blood & Tissue kit
  • FastStart DNA Master SYBR Green I Kit (Roche Diagnostics)
  • Kinetoplast DNA PCR primers: forward, 5‐CCTATTTTACACCAACCCCCAGT‐3 [JW11]; reverse, 5‐GGGTAGGGGCGTTC TGCGAAA‐3 [JW12]
  • Scotch double‐sided sticky tape
  • Magnifying lamp
  • 3/10‐cc tuberculin syringe with a 29‐G, 1/2‐in.needle
  • Calipers (Vernier, dial, or digital)
  • Dissecting equipment
  • 1.5‐ml polypropylene microcentrifuge tubes (autoclaved, preweighed)
  • Pellet pestle for 1.5‐ml microcentrifuge tubes (polypropylene, disposable, sterile)
  • 15‐ml conical centrifuge tubes (e.g., BD Falcon)
  • 24‐well plates
  • 50‐μm pore‐size strainer (BD Falcon)
  • 26°C incubator without CO 2
  • Inverted microscope
  • 56°C water bath
  • NanoDrop microspectrophotometer (Thermo Scientific)
  • 7900 HT Fast Real‐Time PCR System (Applied Biosystems)
  • Additional reagents and equipment for mouse anesthesia (unit 1.4; Donovan and Brown, ) or restraint (unit 1.3; Donovan and Brown, ), injection of mice (unit 1.6; Donovan and Brown, ), footpad disinfection and dissection (see protocol 5), and preparation of spleen or lymph node suspensions (unit 3.1; Kruisbeek, )

Basic Protocol 2: Mouse and Hamster Models of Visceral Leishmaniasis

  Materials
  • Parasite inoculum, either amastigotes or metacyclic promastigotes (see Support Protocols protocol 31 to protocol 64)
  • Dulbecco's minimal essential medium (DMEM) or HBSS without CaCl 2 or MgCl 2 ( appendix 2A)
  • Mice or hamsters (Table 19.2.1)
  • Isoflurane anesthetic (Abbott Laboratories)
  • 70% ethanol
  • LeukoStat stain kit (Fisher) containing fixative, solution I (buffered eosin), and solution II (methylene blue and AzureA)
  • 100% methanol
  • 1‐cc tuberculin syringes and ½‐in. (1.27‐cm) 26‐G needles
  • Additional reagents and equipment for restraint (unit 1.3; Donovan and Brown, ), anesthesia (unit 1.4; Donovan and Brown, ), injection of mouse and hamster (unit 1.6; Donovan and Brown, ), and blood collection by cardiac puncture (unit 1.7; Donovan and Brown, )

Support Protocol 1: Preparation of Metacyclic Promastigotes Using Peanut Agglutinin (PNA)

  Materials
  • Parasites: freshly harvested or frozen stabilates of L. major or L. donovani amastigotes (see Support Protocols protocol 53 and protocol 64) or early passage of promastigotes (ATCC; see protocol 6)
  • Complete medium 199 (C‐M199; see recipe)
  • Dulbecco's minimal essential medium (DMEM) or HBSS without CaCl 2 or MgCl 2 ( appendix 2A)
  • 5 to 10 mg/ml peanut agglutinin (PNA; Vector Labs)
  • 25‐cm2 tissue culture flask
  • 75‐cm2 or 225‐cm2 tissue culture flask (optional)
  • 26°C incubator without CO 2
  • Additional reagents and equipment for counting cells with a hemacytometer ( appendix 3A; Strober, )

Support Protocol 2: Preparation of Metacyclic Promastigotes by Ficoll Density Gradient Centrifugation

  Additional Materials (also see protocol 3)
  • 20% stock solution of Ficoll Type 400 in sterile, endotoxin free water
  • 10% (v/v) Ficoll prepared using 2× PBS
  • 15‐ml conical polypropylene centrifuge tubes
  • Additional reagents and equipment for counting cells with a hemacytometer ( appendix 3A; Strober, )

Support Protocol 3: Purification of Tissue Amastigotes from Footpad or Spleen

  Materials
  • BALB/c mouse with nonulcerative footpad lesion (see protocol 1) or moribund hamster with visceral infection (see protocol 2)
  • 1.75% (v/v) iodine solution (Wescodyne, Amsco)
  • 70% ethanol
  • PBS ( appendix 2A) containing 2 mM EDTA and 50 mM glucose
  • Dulbecco's minimal essential medium (DMEM) or HBSS without CaCl 2 or MgCl 2 ( appendix 2A)
  • 5 mg/ml fluorescein diacetate (FDA; Sigma) in acetone (stable up to 6 months at 4°C)
  • 20 μg/ml propidium iodide (PI; Sigma) in PBS (stable up to 6 months at 4°C)
  • Sterile glass wool
  • 15‐ml Dounce or Ten Broeck tissue homogenizer
  • Additional reagents and equipment for euthanasia of mice counting cells with a hemacytometer ( appendix 3A; Strober, )

Support Protocol 4: Cryopreservation and Thawing of Promastigotes and Amastigotes

  Materials
  • Mid‐log‐phase cultures of Leishmania promastigotes (ATCC; see protocol 3, steps 1 and 2) or freshly isolated amastigotes (see protocol 5)
  • RPMI 1640 medium, 4°C
  • 2× freezing medium (see recipe)
  • 70% ethanol
  • Complete medium 199 (C‐M199; see recipe)
  • Freezing container (e.g., Nalgene Mr. Frosty or microprocessor controlled), prechilled with the outer chamber filled with isopropanol
  • 75‐cm2 tissue culture flask, sterile

Support Protocol 5: Preparation of Blood Agar Plates

  Materials
  • Rabbit blood (unit 1.7)
  • NNN medium (see recipe)
  • 3‐ to 5‐mm glass beads (Thomas)
  • 43°C water bath
  • 96‐well flat‐bottom plates, sterile with cover
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abbasi, I., Aramin, S., Hailu, A., Shiferaw, W., Kassahun, A., Belay, S., Jaffe, C., and Warburg, A. 2013. Evaluation of PCR procedures for detecting and quantifying Leishmania donovani DNA in large numbers of dried human blood samples from a visceral leishmaniasis focus in Northern Ethiopia. BMC Infect. Dis.13:153‐160.
  Adler, J.H. 1989. The origin of the golden hamster as a laboratory animal. Isr. J. Med. Sci. 25:206‐209.
  Ahmed, S., Colmenares, M., Soong, L., Goldsmith‐Pestana, K., Munstermann, L., Molina, R., and McMahon‐Pratt, D. 2003. Intradermal infection model for pathogenesis and vaccine studies of murine visceral leishmaniasis. Infect. Immun. 71:401‐410.
  Alexander, J. and Kaye, P.M. 1985. Immunoregulatory pathways in murine leishmaniasis: Different regulatory control during Leishmania mexicana mexicana and Leishmania major infections. Clin. Exp. Immunol. 61:674‐682.
  Anderson, C.F., Mendez, S., and Sacks, D.L. 2005. Nonhealing infection despite Th1 polarization produced by a strain of Leishmania major in C57BL/6 mice. J. Immunol. 174:2934‐2941.
  Aslan, H., Dey, R., Meneses, C., Castrovinci, P., Jeronimo, S.M., Oliva, G., Fischer, L., Duncan, R.C., Nakhasi, H.L., Valenzuela, J.G., and Kamhawi, S. 2013. A new model of progressive visceral leishmaniasis in hamsters by natural transmission via bites of vector sand flies. J. Infect. Dis. 207:1328‐1338.
  Barral, A., Peterson, E., Sacks, D.L., and Neva, F.A. 1983. Late metastatic disease in the mouse. A model for mucocutaneous leishmaniasis. Am. J. Trop. Med. Hyg. 32:277‐284.
  Belkaid, Y., Mendez, S., Lira, R., Kadambi, N., Milon, G., and Sacks, D. 2000. A natural model of Leishmania major infection reveals a prolonged “silent” phase of parasite amplification in the skin before the onset of lesion formation and immunity. J. Immunol. 165:969‐977.
  Blackwell, J.M. 1996. Genetic susceptibility to leishmanial infections: Studies in mice and man. Parasitology 112:S67‐S74.
  Blackwell, J.M., Freeman, J., and Bradley, D. 1980. Influence of H‐2 complex on acquired resistance to Leishmania donovani infection in mice. Nature 283:72‐74.
  Bradley, D.J. 1977. Regulation of Leishmania populations within the host. II. Genetic control of acute susceptibility of mice to Leishmania donovani infection. Clin. Exp. Immunol. 30:130‐140.
  Bretscher, P.A., Wei, G., Menon, J.N., and Bielefeldt‐Ohmann, H. 1992. Establishment of stable, cell‐mediated immunity that makes susceptible mice resistant to Leishmania major. Science 257:539‐542.
  Castilho, T.M., Goldsmith‐Pestana, K., Lozano, C., Valderrama, L., Saravia, N.G., and McMahon‐Pratt, D. 2010. Murine model of chronic L. (Viannia) panamensis infection: Role of IL‐13 in disease. Eur. J. Immunol. 40:2816‐2829.
  Courret, N., Prina, E., Mougneau, E., Saraiva, E.M., Sacks, D.L., Glaichenhaus, N., and Antoine, J.C. 1999. Presentation of the Leishmania antigen LACK by infected macrophages is dependent upon the virulence of the phagocytosed parasites. Eur. J. Immunol. 29:762‐773.
  Donovan, J. and Brown, P. 1998. Anesthesia. Curr. Protoc. Immunol. 27:1.4.1‐1.4.5.
  Donovan, J. and Brown, P. 2006a. Handling and restraint. Curr. Protoc. Immunol. 73:1.3.1–1.3.6.
  Donovan, J. and Brown, P. 2006b. Parenteral injections. Curr. Protoc. Immunol. 73:1.6.1‐1.6.10.
  Donovan, J. and Brown, P. 2006c. Blood collection. Curr. Protoc. Immunol. 73:1.7.1‐1.7.9.
  Doyle, P.S., Engel, J.C., Pimenta, P.F., da Silva, P.P., and Dwyer, D.M. 1991. Leishmania donovani: Long‐term culture of axenic amastigotes at 37 degrees C. Exp. Parasitol. 73:326‐334.
  Eperon, S. and McMahon‐Pratt, D. 1989. I. Extracellular cultivation and morphological characterization of amastigote‐like forms of Leishmania panamensis and L. braziliensis. J. Protozool. 36:502‐510.
  Giannini, M.S. 1974. Effects of promastigote growth phase, frequency of subculture, and host age on promastigote‐initiated infections with Leishmania donovani in the golden hamster. J. Protozool. 21:521‐527.
  Glaser, T.A., Wells, S.J., Spithill, T.W., Pettitt, J.M., Humphris, D.C., and Mukada, A.J. 1990. Leishmania major and Leishmania donovani: A method for rapid purification of amastigotes. Exp. Parasitol. 71:343‐345.
  Gomes, R., Teixeira, C., Teixeira, M.J., Oliveira, F., Menezes, M.J., Silva, C., de Oliveira, C.I., Miranda, J.C., Elnaiem, D.E., Kamhawi, S., Valenzuela, J.G., and Brodskyn, C.I. 2008. Immunity to a salivary protein of a sand fly vector protects against the fatal outcome of visceral leishmaniasis in a hamster model. Proc. Natl. Acad. Sci. U.S.A. 105:7845‐7850.
  Hill, J.O. and Fahety, J.R. 1987. Leishmania spp.: Agar plating as an alternative approach to limiting dilution and impression smears for the enumeration of viable parasites in tissue. Exp. Parasitol. 63:108‐111.
  Hill, J.O., North, R.J., and Collins, F.M. 1983. Advantages of measuring changes in the number of viable parasites in murine models of experimental cutaneous leishmaniasis. Infect. Immun. 39:1087‐1094.
  Hommel, M., Jaffe, C.L., Travi, B., and Milon, G. 1995. Experimental models for leishmaniasis and for testing anti‐leishmanial vaccines. Ann. Trop. Med. Parasitol. 89:55‐73.
  Howard, J.G., Hale, C., and Chan‐Liew, W.L. 1980. Immunological regulation of experimental cutaneous leishmaniasis. I. Immunological aspects of susceptibility to Leishmania tropica (major) in mice. Parasite Immunol. 2:303‐314.
  Jara, M., Adaui, V., Valencia, B.M., Martinez, D., Alba, M., Castrillon, C., Cruz, M., Cruz, I., Van der Auwera, G., Llanos‐Cuentas, A., Dujardin, J.C., and Arevalo, J. 2013. Real‐time PCR assay for detection and quantification of Leishmania (Viannia) organisms in skin and mucosal lesions: exploratory study of parasite load and clinical parameters. J. Clin. Microbiol. 51:1826‐1833.
  Jones, K.H. and Senft, J.A. 1985. An improved method to determine cell viability by simultaneous staining with fluorescein diacetate‐propidium iodide. J. Histochem. Cytochem. 33:77‐79.
  Joshi, P.B., Sacks, D.L., Modi, G., and McMaster, W.R. 1998. Targeted gene deletion of Leishmania major genes encoding developmental stage‐specific leishmanolysin (GP63). Mol. Microbiol. 27:519‐530.
  Kellina, O.I. 1965. A comparative study of the virulence of L. tropica major strains. Med. Parazitol. Parazit. Bolezni. 34:309‐316.
  Kruisbeek, A. M. 2000. Isolation of mouse mononuclear cells. Curr. Protoc. Immunol. 39:3.1.1‐3.1.5.
  Lira, R., Mendez, S., Carrera, L., Jaffe, C., Neva, F., and Sacks, D. 1998. Leishmania tropica: The identification and purification of metacyclic promastigotes and use in establishing mouse and hamster models of cutaneous and visceral disease. Exp. Parasitol. 89:331‐342.
  Lira, R., Doherty, M., Modi, G., and Sacks, D. 2000. Evolution of lesion formation, parasitic load, immune response, and reservoir potential in C57BL/6 mice following high‐ and low‐dose challenge with Leishmania major. Infect. Immun. 68:5176‐5182.
  Mahoney, A.B., Sacks, D.L., Saraiva, E., Modi, G., and Turco, S.J. 1999. Intra‐species and stage‐specific polymorphisms in lipophosphoglycan structure control Leishmania donovani–sand fly interactions. Biochemistry 38:9813‐9823.
  McConville, M., Turco, S., Ferguson, M., and Sacks, D. 1992. Developmental modification of lipophosphoglycan: During the differentiation of Leishmania major promastigotes to an infectious stage. EMBO J. 11:3593‐3600.
  McConville, M.J., Schnur, L.F., Jaffe, C., and Schneider, P. 1995. Structure of Leishmania lipophosphoglycan Inter‐ and intra‐specific polymorphism in Old World species. Biochem. J. 310:807‐818.
  Melby, P.C., Tryon, V.V., Chandrasekar, B., and Freeman, G.L. 1998a. Cloning of Syrian hamster (Mesocricetus auratus) cytokine cDNAs and analysis of cytokine mRNA expression in experimental visceral leishmaniasis. Infect. Immun. 66:2135‐2142.
  Melby, P.C., Yang, Y.‐Z., Cheng, J., and Zhao, W. 1998b. Regional differences in the cellular immune response to experimental cutaneous or visceral infection with Leishmania donovani. Infect. Immun. 66:18‐27.
  Mitchell, G.F., Handman, E., and Spithill, T.W. 1984. Vaccination against cutaneous leishmaniasis in mice using nonpathogenic cloned promastigotes of Leishmania major and importance of route of injection. Aust. J. Exp. Biol. Med. Sci. 62:145‐153.
  Nabors, G.S. and Farell, J.P. 1994. Site‐specific immunity to Leishmania major in SWR mice: The site of infection influences susceptibility and the expression of the antileishmanial immune response. Infect. Immun. 62:3655‐3662.
  Nicolas, L., Prina, E., Lang, T., and Milon, G. 2002. Real‐time PCR for detection and quantitation of leishmania in mouse tissues. J. Clin Microbiol. 40:1666‐1669.
  Pan, A. 1984. Leishmania mexicana: Serial cultivation of intracellular stages in a cell‐free medium. Exp. Parasitol. 58:72‐80.
  Pearson, R.D., Cox, G., Evans, T., Smith, D.L., Weidel, D., and Castracane, J. 1990. Wasting and macrophage production of tumor necrosis factor/cachectin and interleukin 1 in experimental visceral leishmaniasis. Am. J. Trop. Med. Hyg. 43:640‐649.
  Perez, H., Labrador, F., and Torealba, J.W. 1979. Variations in the response of five strains of mice to Leishmania mexicana. Int. J. Parasitol. 9:27‐32.
  Pinto‐da‐Silva, L.H., Camurate, M., Costa, K.A., Oliveira, S.M., da Cunha‐e‐Silva, N.L., and Saraiva, E.M. 2002. Leishmania (Viannia) braziliensis metacyclic promastigotes purified using Bauhinia purpurea lectin are complement resistant and highly infective for macrophages in vitro and hamsters in vivo. Int. J. Parasitol. 32:1371‐1377.
  Preston, P.M. and Dumonde, D.C. 1976. Experimental cutaneous leishmaniasis. V. Protective immunity in subclinical and self‐healing infections in the mouse. Clin. Exp. Immunol. 23:126‐138.
  Prina, E., Roux, E., Mattei, D., and Milon, G. 2007. Leishmania DNA is rapidly degraded following parasite death: An analysis by microscopy and real‐time PCR. Microbes Infect. 9:1307‐1315.
  Rey, J.A., Travi, B., Valencia, A.Z., and Saravia, N.G. 1990. Infectivity of the subspecies of the Leishmania braziliensis complex in vivo and in vitro. Am. J. Trop. Med. Hyg. 43:89‐193.
  Ribeiro‐Gomes, F.L., Roma, E.H., Carneiro, M.B.H., Sacks, D.L., and Peters, N.C. 2014. Site dependent recruitment of inflammatory cells determines the effective dose of Leishmania major. Infect. Immun. In press.
  Romero, I., Tellez, J., Suarez, Y., Cardona, M., Figueroa, R., Zelazny, A., and Saravia, N. 2010. Viability and burden of Leishmania in extralesional sites during human dermal leishmaniasis. PLoS Negl. Trop. Dis. 4‐12.
  Sacks, D.L. 1989. Metacyclogenesis in Leishmania promastigotes. Exp. Parasitol. 69:100‐103.
  Sacks, D. and Kamhawi, S. 2001. Molecular aspects of parasite‐vector and vector‐host interactions in leishmaniasis. Annu. Rev. Microbiol. 55:453‐483.
  Sacks, D.L. and Perkins, P.V. 1984. Identification of an infective stage of Leishmania promastigotes. Science 223:1417‐1419.
  Sacks, D.L., Hieny, S., and Sher, A. 1985. Identification of cell surface carbohydrate and antigenic changes between noninfective and infective developmental stages of Leishmania major promastigotes. J. Immunol. 135:564‐569.
  Sacks, D.L., Pimenta, P.F., McConville, M.J., Schneider, P., and Turco, S.J. 1995. Stage‐specific adhesion of Leishmania donovani to the sand fly vector midgut is regulated by conformational changes in the abundant surface lipophosphoglycan. J. Exp. Med. 181:685‐697.
  Saraiva, E.M.B., Pimenta, P., Pereira, M., and DeSouza, W. 1983. Isolation and purification of amastigotes of Leishmania mexicana amazonensis by a gradient of metrizamide. J. Parasitol. 69:627‐629.
  Scott, P.A. and Farrell, J.P. 1982. Experimental cutaneous leishmaniasis: Disseminated leishmaniasis in genetically susceptible and resistant mice. Am. J. Trop. Med. Hyg. 31:230‐238.
  Serafim, T.D., Figueiredo, A.B., Costa, P.A., Marques‐da‐Silva, E.A., Goncalves, R., de Moura, S.A., Gontijo, N.F., da Silva, S.M., Michalick, M.S., Meyer‐Fernandes, J.R., de Carvalho, R.P., Uliana, S.R., Fietto, J.L., and Afonso, L.C. 2012. Leishmania metacyclogenesis is promoted in the absence of purines. PLoS Negl. Trop. Dis. 6:e1833.
  Soares, R.P., Macedo, M.E., Ropert, C., Gontijo, N.F., Almeida, I.C., Gazzinelli, R.T., Pimenta, P.F., and Turco, S.J. 2002. Leishmania chagasi: Lipophosphoglycan characterization and binding to the midgut of the sand fly vector Lutzomyia longipalpis. Mol. Biochem. Parasitol. 121:213‐224.
  Spath, G.F. and Beverley, S.M. 2001. A lipophosphoglycan‐independent method for isolation of infective Leishmania metacyclic promastigotes by density gradient centrifugation. Exp. Parasitol. 99:97‐103.
  Stauber, L.A. 1966. The origin and significance of the distribution of parasites in visceral leishmaniasis. Trans. N.Y. Acad. Sci. 28:635‐643.
  Strober, W. 1997. Monitoring cell growth. Curr. Protoc. Immunol. 21:3A.1‐A.3A.2.
  Taswell, C. 1981. Limiting dilution assays for the determination of immunocompetent cell frequencies. I. Data analysis. J. Immunol. 126:1614‐1619.
  Titus, R.G., Marchand, M., Boon, T., and Louis, J.A. 1985. A limiting dilution assay for quantifying Leishmania major in tissues of infected mice. Parasite Immunol. 7:545‐555.
  van den Bogaart, E., Schoone, G.J., Adams, E.R., and Schallig, H.D. 2014. Duplex quantitative Reverse‐Transcriptase PCR for simultaneous assessment of drug activity against Leishmania intracellular amastigotes and their host cells. Int. J. Parasitol. Drugs Drug Resist. 4:14‐9.
  van der Meide, W., Guerra, J., Schoone, G., Farenhorst, M., Coelho, L., Faber, W., Peekel, I., and Schallig, H. 2008. Comparison between quantitative nucleic acid sequence‐based amplification, real‐time reverse transcriptase PCR, and real‐time PCR for quantification of Leishmania parasites. J. Clin. Microbiol. 46:73‐8.
  Vidal, S.M., Malo, D., Vogan, K., Skamene, E., and Gros, P. 1993. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 73:469‐485.
  Yokoyama, W.M., Thompson, M.L. and Ehrhardt, R.O. 2012. Cryopreservation and thawing of cells. Curr. Protoc. Immunol. 99:A.3G.1‐A.3G.5.
  Zakai, H.A., Chance, M.L., and Bates, P.A. 1998. In vitro stimulation of metacyclogenesis in Leishmania braziliensis, L. donovani, L. major, and L. mexicana. Parasitology 116:305‐309.
Key References
  Hommel et al., 1995. See above.
  Thorough review of animal models for cutaneous and visceral leishmaniasis.
  Sacks and Kamhawi, 2001. See above.
  Reviews promastigote developmental biology and explains the basis for metacyclic identification and purification.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library