Experimental Asexual Blood Stage Malaria Immunity

Fiona H. Amante1, Christian R. Engwerda1, Michael F. Good2

1 The Queensland Institute of Medical Research, Queensland, Australia, 2 Institute for Glycomics, Gold Coast Campus, Griffith University, Queensland, Australia
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 19.4
DOI:  10.1002/0471142735.im1904s93
Online Posting Date:  April, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Immunity to asexual blood stages of malaria is complex, involving both humoral and cell‐mediated immune mechanisms. The availability of murine models of malaria has greatly facilitated the analysis of immune mechanisms involved in resistance to the asexual blood stages. This unit details the materials and methods required for inducing protective immunity toward experimental blood stage malaria parasites by vaccination, repeated infection, and drug cure, as well as adoptive transfer of antigen‐specific T cells. Curr. Protoc. Immunol. 93:19.4.1‐19.4.26. © 2011 by John Wiley & Sons, Inc.

Keywords: malaria; Plasmodium; blood stage; immunity; protection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Induction of Malaria Immunity by Immunization with Recombinant Malaria Asexual Blood Stage Proteins
  • Alternate Protocol 1: Induction of Malaria Immunity by Immunization with Crude Asexual Blood Stage Parasite Antigens
  • Basic Protocol 2: Induction of Malaria Immunity by Infection and Drug Cure
  • Basic Protocol 3: Induction of Malaria Immunity by Adoptive Transfer of Antigen‐Specific T Cells
  • Support Protocol 1: Infection of Mice with Asexual Blood Stage Malaria Parasites
  • Support Protocol 2: Cryopreservation of Malaria Asexual Blood Stage Parasites
  • Support Protocol 3: Preparation of Asexual Blood Stage Malaria Parasite Antigens
  • Support Protocol 4: Assessment of Progression of Infection
  • Measurement of Immune Responses
  • Support Protocol 5: Detection of Blood Brain Barrier (BBB) Breakdown by Measurement of Evans Blue Leakage
  • Support Protocol 6: Measurement of Antigen‐Specific T Cell Proliferation In Vitro
  • Support Protocol 7: Measurement of Antigen‐Specific TCR Transgenic T Cell Expansion and Proliferation In Vivo
  • Support Protocol 8: Detection of Infiltrating Leukocytes in the Brain of P. berghei ANKA–Infected Mice
  • Support Protocol 9: Measurement of Cytokines in Serum and Culture Supernatants
  • Support Protocol 10: Detection of Intracellular Cytokines
  • Support Protocol 11: Measurement of Malaria‐Specific Antibodies
  • Support Protocol 12: Measurement of Serum Nitric Oxide
  • Reagents and Solutions
  • Commentary
  • Literature Cited
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Induction of Malaria Immunity by Immunization with Recombinant Malaria Asexual Blood Stage Proteins

  Materials
  • 400 µg/ml S. cerevisiae–expressed recombinant MSP1 19 (rMSP1 19; see Tian et al., ) in phosphate‐buffered saline (PBS; appendix 2A)
  • Complete Freund's Adjuvant H37Ra (CFA; BD Difco)
  • Specific‐pathogen‐free female BALB/c mice; 6 to 7 weeks old
  • Incomplete Freunds Adjuvant (IFA; BD Difco)
  • Phosphate buffered saline (PBS), pH 7.2 ( appendix 2A)
  • RPMI 1640 medium (e.g., Invitrogen)
  • Parasite inoculum (see protocol 5)
  • Hamilton gas‐tight syringes
  • 18‐ and 26‐G needles
  • ∼2‐mm diameter polymer connecting tube with luer locks
  • Beaker
  • 1.5‐ml microcentrifuge tubes
  • 1‐ml syringes
  • Additional reagents and equipment for subcutaneous, intraperitoneal, and intravenous injection (unit 1.6), collection of blood from tail vein of mice (unit 1.7), monitoring of peripheral parasitemia and preparation of parasite inoculum ( protocol 5), assessing progression of infection ( protocol 8), and measuring immune responses (Support Protocols protocol 95 to protocol 1612)
NOTE: All materials and solutions coming in contact with samples that will be injected into mice must be sterile.

Alternate Protocol 1: Induction of Malaria Immunity by Immunization with Crude Asexual Blood Stage Parasite Antigens

  • Killed whole blood stage lysate (see protocol 7)
  • CpG ODN: phosphorothioate‐modified ODN sequence 1826 containing 2 CpG motifs (underlined: TCCATGACGTTCCTGACGTT) and control sequence 1982 (TCCAGGACTTCTCTCAGGTT); Sigma‐Aldrich (custom‐synthesized; http://www.sigmaaldrich.com/life‐science/custom‐oligos)
  • Aluminum hydroxide (alum; Imject Alum, Pierce)
  • Specific‐pathogen‐free female A/J mice; 6‐7 weeks old
  • 0.9% saline
  • Parasite inoculum (see protocol 5)
  • 26‐G needles
  • 1‐ml syringes

Basic Protocol 2: Induction of Malaria Immunity by Infection and Drug Cure

  Materials
  • Malaria‐infected passage BALB/c mice (e.g., with P. vinckei vinckei, P. yoelii 17×L, or P. berghei ANKA) ( protocol 5)
  • RPMI 1640 medium (e.g., Invitrogen)
  • Specific‐pathogen‐free female BALB/c mice; 6‐ to 7‐weeks old
  • 2.5 mg/ml chloroquine diphosphate (Sigma; prepare fresh and keep in foil‐wrapped bottle)
  • Phosphate‐buffered saline (PBS), pH 7.2 ( appendix 2A)
  • 26‐G needles
  • 1‐ml syringes
  • Additional reagents and equipment for preparation of parasite inoculum and monitoring of peripheral parasitemia ( protocol 5), intravenous, intraperitoneal, and subcutaneous injection (unit 1.6), collection of blood from tail vein (unit 1.7), assessing progression of infection ( protocol 8), and measuring immune responses (Support Protocols protocol 95 to protocol 1612)

Basic Protocol 3: Induction of Malaria Immunity by Adoptive Transfer of Antigen‐Specific T Cells

  Materials
  • Parasitized RBC lysate (source of malaria blood stage antigens; see protocol 7, steps 1 to 9)
  • Complete Freunds Adjuvant H37Ra (CFA; BD Difco)
  • Specific‐pathogen‐free female BALB/c and BALB/c nu/nu mice, 6 to 8 weeks old
  • Earle's minimum essential medium (EMEM; see recipe)
  • Complete EMEM‐10 (see recipe)
  • Parasitized RBCs (used as antigen source for in vitro stimulation cultures; see protocol 5)
  • 1‐ml and 5‐ml syringes, and plungers from 10‐ml syringes
  • 18‐G and 26‐G needles
  • 60 × 15–mm petri dishes
  • 50‐ml conical centrifuge tubes
  • Centrifuge with Beckman GH‐3.7 rotor (or equivalent)
  • 24‐well and 6‐well plates (Costar)
  • γ irradiator (alternatively use mitomycin C treatment as described in unit 3.12)
  • Additional reagents and equipment for preparation of an emulsion of malaria parasite antigen and CFA (see protocol 1, step 1), intraperitoneal and subcutaneous injection (unit 1.6), euthanasia by CO 2 asphyxiation (unit 1.8), removal of lymphoid organs (unit 1.9), preparation of single‐cell suspensions and isolation of T lymphocytes by density gradient (unit 3.1), enumeration of viable cells by trypan blue exclusion ( appendix 3B), monitoring peripheral blood parasitemia and preparation of parasite inoculum for infection, ( protocol 5), assessment of progression of infection (see protocol 8), and measurement of immune responses (see Support Protocols protocol 95 to protocol 1612)
NOTE: All solutions and equipment coming into contact with cells must be sterile, and aseptic technique should be used accordingly.NOTE: All culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 1: Infection of Mice with Asexual Blood Stage Malaria Parasites

  Materials
  • Cryopreserved stabilates of asexual blood stage malaria parasites (see protocol 6)
  • Specific‐pathogen‐free female A/J, BALB/c or C57BL/6 mice, 6‐ to 8‐weeks old
  • Diff‐Quik stain solutions I, II, and III (e.g., Baxter)
  • RPMI 1640 medium ( appendix 2A), 4°C
  • Phosphate‐buffered saline (PBS), pH 7.2 ( appendix 2A), containing 15% (w/v) glucose
  • 26‐G needles
  • 1‐ml syringes
  • Microscope slides
  • Microscope with 100× oil‐immersion objective
  • 10‐ml heparinized centrifuge tubes
  • Centrifuge with Beckman GH‐3.7 rotor (or equivalent)
  • Additional reagents and equipment for intraperitoneal and intravenous injection of mice (unit 1.6), obtaining blood via tail vein bleeding or cardiac puncture (unit 1.7), and counting cells using a hemacytometer ( appendix 3B)
NOTE: All solutions and equipments coming into contact with cells must be sterile, and aseptic technique should be used accordingly.

Support Protocol 2: Cryopreservation of Malaria Asexual Blood Stage Parasites

  Materials
  • 20 to 40 malaria‐infected female mice; 6‐ to 8‐weeks old (see protocol 5)
  • RPMI 1640 medium (supplemented with 100 U/ml penicillin and 100 µg/ml streptomycin sulfate; appendix 2A), 4°C
  • Parasite freezing medium (see recipe), 4°C
  • Liquid N 2 (optional)
  • 10‐ml heparinized tubes
  • Centrifuge with Beckman GH‐3.7 rotor (or equivalent)
  • Syringe and 18‐G needle
  • Eppendorf centrifuge model 5810R with A–4–81 rotor (or equivalent centrifuge and rotor)
  • 1‐ml cryovials
  • Additional reagents and equipment for determining peripheral blood parasitemia (see protocol 5), euthanasia of mice by CO 2 asphyxiation (unit 1.8), and obtaining blood via cardiac puncture (unit 1.7)
NOTE: All solutions and equipments coming into contact with red blood cells must be sterile, and proper sterile technique should be used accordingly.NOTE: All solutions coming into contact with red blood cells must be at 4°C.

Support Protocol 3: Preparation of Asexual Blood Stage Malaria Parasite Antigens

  Materials
  • Parasitized red blood cells from 20 to 30 malaria‐infected A/J, BALB/c or C57BL/6 mice (see protocol 5)
  • Phosphate‐buffered saline (PBS), pH 7.2 ( appendix 2A), 4°C
  • 10‐ml heparinized tubes or 50‐ml tube containing RPMI 1640 medium supplemented with 1 U/ml heparin (1 ml per mouse)
  • 10‐ml or 50‐ml centrifuge tubes
  • Eppendorf centrifuge model 5810R with A–4–81 rotor (or equivalent centrifuge and rotor)
  • Eppendorf centrifuge model 5415D with F45–24–11 rotor (or equivalent centrifuge and rotor)
  • 1‐ml syringes and 26‐G needles
  • Probe sonicator
  • BCA protein assay kit (Pierce)
  • Additional reagents and equipment for determining parasitemia ( protocol 5) and collection of blood via cardiac puncture (unit 1.7)
NOTE: All solutions coming into contact with parasites must be at 4°C.

Support Protocol 4: Assessment of Progression of Infection

  Materials
  • Transgenic P. berghei ANKA (231c1l) expressing luciferase and green fluorescent protein (GFP) under the control of the ef1‐α promoter (Franke‐Fayard et al., ; Amante et al., )
  • Isoflurane (2‐chloro‐2‐(difluoromethoxy)‐1,1,1‐trifluoro‐ethane) inhalation anesthesia
  • 15 mg/ml D‐Luciferin, potassium salt (Caliper LifeSciences) diluted in Dulbecco's phosphate‐buffered saline (DPBS) without Ca2+ and Mg2+ (e.g., Invitrogen)
  • Specific‐pathogen‐free female C57BL/6 mice infected with luciferase expressing transgenic P. berghei ANKA parasites (see protocol 5)
  • Xenogen IVIS 100 series or IVIS Spectrum imaging system (Caliper LifeSciences)
  • 26‐G needles
  • 1‐ml syringes
  • Living Image (Xenogen) and IgorPro software (WaveMetrics)
  • Additional reagents and equipment for subcutaneous injection (unit 1.6)

Support Protocol 5: Detection of Blood Brain Barrier (BBB) Breakdown by Measurement of Evans Blue Leakage

  Materials
  • P. berghei ANKA–infected mice displaying neurological signs (e.g., limb paralysis, convulsions or coma)
  • 1% (w/v) Evans blue dye solution in 0.9% saline, filter sterilized
  • N,N‐dimethylformamide
  • 10‐ml syringes
  • 26‐G needles
  • 50°C water bath
  • Eppendorf centrifuge model 5415D with F45– 24– 11 (or equivalent centrifuge and rotor)
  • 96‐well flat‐bottom plates
  • ELISA plate reader
  • Rotor‐stator homogenizer
  • Additional reagents and equipment for injection of mice (unit 1.6) and euthanasia of mice (unit 1.8)

Support Protocol 6: Measurement of Antigen‐Specific T Cell Proliferation In Vitro

  Materials
  • Antigen: parasitized red blood cells (see protocol 5)
  • Positive control antigen: concanavalin A (Con A)
  • EMEM‐10 (see recipe)
  • Effector cells:
    • Malaria‐specific T cells maintained in culture (see protocol 7)
    • MACS purified CD4+ T cells from spleens harvested 4 days post infection
  • Antigen presenting cells (see protocol 4 and unit 3.12)
  • [3H]thymidine (sp. act., 6.7 Ci/mol)
  • 96‐well round‐bottom tissue culture microtiter plates (Nunc)
  • 37°C, 5% CO 2 incubator
  • Automated cell harvester with filter mats
  • Liquid scintillation counter
  • Additional reagents and equipment for counting viable cells by trypan blue exclusion ( appendix 3B), isolation of CD4+ T cells by MACS (unit 3.5), and preparing irradiated or mitomycin C–treated antigen‐presenting cells ( protocol 4 and unit 3.12)
NOTE: All solutions and equipment coming into contact with cells must be sterile, and aseptic technique should be used accordingly.NOTE: All culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise indicated.

Support Protocol 7: Measurement of Antigen‐Specific TCR Transgenic T Cell Expansion and Proliferation In Vivo

  Materials
  • Specific‐pathogen‐free female B6.SJL‐Ptprc congenic (CD45.1+) × OT‐I and OT‐II transgenic mice and C57BL/6 mice; 6 to 8 weeks old
  • Transgenic P. berghei ANKA parasites expressing MHC II–restricted ovalbumin (OVA) epitopes fused to GFP under the control of the ef1‐α promoter (PbTG; Lundie et al., )
  • Control transgenic P. berghei ANKA parasites expressing only GFP (PbG; Lundie et al., )
  • Pyrimethamine dissolved in drinking water at 10 mg/ml to select for transgenic parasites (see recipe)
  • RPMI 1640 medium (see recipe)
  • MACS buffer, degassed, (see recipe), 4°C
  • Dulbecco's phosphate‐buffered saline (DPBS) without Ca2+ and Mg2+ (Invitrogen)
  • 4 µM carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes) in DPBS without Ca2+ and Mg2+
  • Normal mouse serum (see recipe)
  • 15‐ml conical tubes (e.g., BD Falcon)
  • 1‐ml and 5‐ml syringes
  • 80 × 15–mm petri dishes
  • 100‐µm nylon cell strainers (BD Falcon)
  • 26‐G needles
  • Additional reagents and equipment for injection of mice (unit 1.6), preparing a blood smear for determining malaria parasitemia ( protocol 5), euthanasia of mice (unit 1.8), flow cytometry (Chapter 5), counting viable cells by trypan blue exclusion ( appendix 3B), and isolation of CD4+ and CD8+ T cells by MACS purification (unit 3.5)
NOTE: All solutions and equipment coming into contact with cells must be sterile, and aseptic technique should be used accordingly.

Support Protocol 8: Detection of Infiltrating Leukocytes in the Brain of P. berghei ANKA–Infected Mice

  Materials
  • P. berghei‐infected mice exhibiting end‐stage ECM (limb paralysis, convulsions or coma)
  • Phosphate‐buffered saline (PBS; appendix 2A), pH 7.2
  • Collagenase/DNase digestion medium (see recipe)
  • 2% FBS/PBS: phosphate‐buffered saline (PBS), pH 7.2 ( appendix 2A) supplemented with 2% fetal bovine serum (heat‐inactivated FBS; appendix 2A)
  • 33% Percoll density gradient (see recipe)
  • RBC lysis buffer (Sigma)
  • 26‐G needles
  • 10‐ml syringes
  • 100‐µm nylon cell strainers (BD Falcon)
  • 15‐ml conical centrifuge tubes (e.g., BD Falcon)
  • Eppendorf centrifuge model 5810R with A–4–81 rotor (or equivalent centrifuge and rotor)
  • Additional reagents and equipment for euthanasia of mice (unit 1.8)

Support Protocol 9: Measurement of Cytokines in Serum and Culture Supernatants

  Materials
  • Test serum samples (see unit 2.4 for serum preparation)
  • Sodium nitrite
  • Sodium nitrate
  • Normal mouse serum
  • 10 U/ml nitrate reductase (Boehringer Mannheim)
  • 1.25 mg/ml NADPH in distilled water
  • Greiss reagent (see recipe)
  • 10% trichloroacetic acid
  • 1.5‐ml microcentrifuge tubes
  • 96‐well flat‐bottomed microtiter plates (e.g., Nunc)
  • Eppendorf centrifuge model 5415D with F45–24–11 (or equivalent centrifuge and rotor)
  • ELISA microtiter plate reader (540 nm test wavelength, 630 nm reference wavelength)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Amante, F.H. and Good, M.F. 1997. Prolonged Th1‐like response generated by a Plasmodium yoelii–specific T cell clone allows complete clearance of infection in reconstituted mice. Parasite Immunol. 19:111‐126.
   Amante, F.H., Stanley, A.C., Randall, L.M., Zhou, Y., Haque, A., McSweeney, K., Waters, A.P., Janse, C.J., Good, M.F., Hill, G.R., and Engwerda, C.R. 2007. A role for natural regulatory T cells in the pathogenesis of experimental cerebral malaria. Am. J. Pathol. 171:548‐559.
   Amante, F.H., Haque, A., Stanley, A.C., de Labastida Rivera, F., Randall, L.M., Wilson, Y.A., Yeo, G., Crabb, B.S., de Koning‐Ward, T.F., Lundie, R.J., Good, M.F., Pinzon‐Charry, A., Pearson, M.S., Duke, M.G., McManus, D.P., Loukas, A., Hill, G.R., and Engwerda, C.R. 2010. Immune‐mediated mechanisms of parasite tissue sequestration during experimental cerebral malaria. J. Immunol. 185:3632‐3642.
   Brake, D.A., Weidanz, W.P., and Long, C.A. 1986. Antigen‐specific, interleukin 2–propagated T lymphocytes confer resistance to a murine malaria parasite, Plasmodium chabaudi adami. J. Immunol. 137:347‐352.
   Brake, D.A., Long, C.A., and Weidanz, W.P. 1988. Adoptive protection against Plasmodium chabaudi adami malaria in athymic nude mice by a cloned T cell line. J. Immunol. 140:1989‐1993.
   Bruce‐Chwatt, L.J. 1985. Diagnostic methods in malaria. In Essential Malariology (L.J. Bruce‐Chwatt, ed.) pp. 103‐126. The Alden Press, Oxford.
   Bouharoun‐Tayoun, H., Attanath, P., Sabchareon, A., Chongsuphajaisiddhi, T., and Druilhe, P. 1990. Antibodies that protect humans against Plasmodium falciparum blood stages do not on their own inhibit parasite growth and invasion in vitro, but act in cooperation with monocytes. J. Exp. Med. 172:1633‐1641.
   Cavacini, L.A., Long, C.A., and Weidanz, W.P. 1986. T‐cell immunity in murine malaria: Adoptive transfer of resistance to Plasmodium chabaudi adami. Infect. Immun. 52:637‐643.
   Cavacini, L.A., Parke, L.A., and Weidanz, W.P. 1990. Resolution of acute malarial infections by T‐cell dependant non‐antibody‐mediated mechanisms of immunity. Infect. Immun. 58:2946‐2950.
   Clark, I.A. and Cowden, W.B. 2003. The pathophysiology of falciparum malaria. Pharmacol. Ther. 99:221‐260.
   Dondorp, A.M., Desakorn, V., Pongtavornpinyo, W., Sahassananda, D., Silamut, K., Chotivanich, K., Newton, P.N., Pitisuttithum, P., Smithyman, A.M., White, N.J., and Day, N.P. 2005. Estimation of the total parasite biomass in acute falciparum malaria from plasma PfHRP2. PLoS Med. 2:e204.
   Engwerda, C.R., Mynott, T.L., Sawhney, S., De Souza, J.B., Bickle, Q.D., and Kaye, P.M. 2002. Locally up‐regulated lymphotoxin alpha, not systemic tumor necrosis factor alpha, is the principal mediator of murine cerebral malaria. J. Exp. Med. 195:1371‐1377.
   Franke‐Fayard, B., Janse, C.J., Cunha‐Rodrigues, M., Ramesar, J., Buscher, P., Que, I., Lowik, C., Voshol, P.J., den Boer, M.A., van Duinen, S.G., Febbraio, M., Mota, M.M., and Waters, A.P. 2005. Murine malaria parasite sequestration: CD36 is the major receptor, but cerebral pathology is unlinked to sequestration. Proc. Natl. Acad. Sci. U.S.A. 102:11468‐11473.
   Franke‐Fayard, B., Fonager, J., Braks, A., Khan, S.M., and Janse, C.J. 2010. Sequestration and tissue accumulation of human malaria parasites: Can we learn anything from rodent models of malaria. Plos Pathogens 6:e1001032.
   Grau, G.E., Piguet, P.F., Engers, H.D., Louis, J.A., Vassalli, P., and Lambert, P.H. 1986. L3T4+ T lymphocytes play a major role in the pathogenesis of murine cerebral malaria. J. Immunol. 137:2348‐2354.
   Grau, G.E., Fajardo, L.F., Piguet, P.F., Allet, B., Lambert, P.H., and Vassalli, P. 1987. Tumor necrosis factor (cachectin) as an essential mediator in murine cerebral malaria. Science 237:1210‐1212.
   Grau, G.E., Heremans, H., Piguet, P.F., Pointaire, P., Lambert, P.H., Billiau, A., and Vassalli, P. 1989. Monoclonal antibody against interferon gamma can prevent experimental cerebral malaria and its associated overproduction of tumor necrosis factor. Proc. Natl. Acad. Sci. U.S.A. 86:5572‐5574.
   Grun, J.L. and Weidanz, W.P. 1983. Antibody‐independent immunity to reinfection malaria in B‐cell deficient mice. Infect. Immun. 41:1197‐1204.
   Hermsen, C., van de Wiel, T., Mommers, E., Sauerwein, R., and Eling, W. 1997. Depletion of CD4+ or CD8+ T‐cells prevents Plasmodium berghei induced cerebral malaria in end‐stage disease. Parasitology 114:7‐12.
   Hirunpetcharat, C., Tian, J.H., Kaslow, D.C., van Rooijen, N., Kumar, S., Berzofsky, J.A., Miller, L.H., and Good, M.F. 1997. Complete protective immunity induced in mice by immunization with the 19‐kilodalton carboxyl‐terminal fragment of the merozoite surface protein‐1 (MSP119) of Plasmodium yoelii expressed in Saccharomyces cerevisiae: Correlation of protection with antigen‐specific antibody titer, but not with effector CD4+ T cells. J. Immunol. 159:3400‐3411
   Hoffman, S.L., Oster, C.N., Plowe, C.V., Woollett, G.R., Beier, J.C., Chulay, J.D., Wirtz, R.A., Hollingdale, M.R., and Mugambi, M. 1987. Naturally acquired antibodies to sporozoites do not prevent malaria: Vaccine development implications. Science 237:639‐642.
   Hunt, N.H., Golenser, J., Chan‐Ling, T., Parekh, S., Rae, C., Potter, S., Medana, I.M., Miu, J., and Ball, H.J. 2006. Immunopathogenesis of cerebral malaria. Int. J. Parasitol. 36:569‐582.
   Jayawardena, A.N., Murphy, D.B., Janeway, C.A., and Gershon, R.K. 1982. T cell‐mediated immunity in malaria. I. The Ly phenotype of T cells mediating resistance to Plasmodium yoelii. J. Immunol. 129:377‐381.
   Kumar, S., Good, M.F., Dontfraid, F., Vinstz, J.M., and Miller, L.H. 1989. Interdependence of CD4+ T cells and malarial spleen in immunity to Plasmodium vinckei vinckei: Relevance to vaccine development. J. Immunol. 143:2017‐2023.
   Lundie, R., de Koning‐Ward, T., Davey, G.M., Nie, C.Q., Hansen, D.S., Lau, L.S., Mintern, J.D., Belz, G.T., Schofield, L., Carbone, F.R., Villadangos, J.A., Crabb, B.S., and Heath, W.R. 2008. Blood stage Plasmodium infection induces CD8+ T lymphocytes to parasite‐expressed antigens, largely regulated by CD8α+ dendritic cells. Proc. Natl. Acad. Sci. U.S.A. 105:14509‐14514.
   McGregor, I.A. 1974. Mechanisms of acquired immunity and epidemiological patterns of antibody responses in malaria in man. Bull. World Health Organ. 50:259‐266.
   Meding, S.J. and Langhorne, J. 1991. CD4+ T cells and B cells are necessary for the transfer of protective immunity to Plasmodium chabaudi chabaudi. Eur. J. Immunol. 21:1433‐1438.
   Miyakoda, M., Kimura, D., Yuda, M., Chinzei, Y., Shibata, Y., Honma, K., and Yui, K. 2008. Malaria‐specific and nonspecific activation of CD8+ T cells during blood stage of Plasmodium berghei infection. J. Immunol. 181:1420‐1428.
   Mota, M.M., Brown, K.N., Holder, A.A., and Jarra, W. 1998. Acute Plasmodium chabaudi chabaudi malaria infection induces antibodies which bind to the surfaces of parasitized erythrocytes and promote their phagocytosis by macrophages in vitro. Infect Immun. 66:4080‐4086.
   Nitcheu, J., Bonduelle, O., Combadiere, C., Tefit, M., Seilhean, D., Mazier, D., and Combadiere, B. 2003. Perforin‐dependent brain‐infiltrating cytotoxic CD8+ T lymphocytes mediate experimental cerebral malaria pathogenesis. J. Immunol. 170:2221‐2228.
   Ockenhouse, C.F., Schulman, S., and Shear, H.L. 1984. Induction of crisis forms in the human malaria parasite Plasmodium falciparum by gamma‐interferon‐activated, monocyte‐derived macrophages. J. Immunol. 133:1601‐1608.
   Perlmann, H., Kumar, S., Vinetz, J.M., Kullberg, M., Miller, L.H., and Perlmann, P. 1995. Cellular mechanisms in the immune response to malaria in Plasmodium vinckei–infected mice. Infect. Immun. 63:3987‐3993
   Pinzon‐Charry, A., McPhun, V., Kienzle, V., Hirunpetcharat, C., Engwerda, C., McCarthy, J., and Good, M.F. 2010. Low doses of killed parasite in CpG elicit vigorous CD4+ T cell responses against blood‐stage malaria in mice. J. Clin. Invest. 120:2967.
   Podoba, J.E. and Stevenson, M.M. 1991. CD4+ and CD8+ T lymphocytes both contribute to acquired immunity to blood‐stage Plasmodium chabaudi AS. Infect. Immun. 59:51‐58.
   Potter, S., Chaudhri, G., Hansen, A., and Hunt, N.H. 1999. Fas and perforin contribute to the pathogenesis of murine cerebral malaria. Redox Rep. 4:333‐335.
   Potter, S., Chan‐Ling, T., Ball, H.J., Mansour, H., Mitchell, A., Maluish, L., and Hunt, N.H. 2006. Perforin mediated apoptosis of cerebral microvascular endothelial cells during experimental cerebral malaria. Int. J. Parasitol. 36:485‐496.
   Roberts, D.W. and Weidanz, W.P. 1979. T‐cell immunity to malaria in the B‐cell deficient mouse. Am. J. Trop. Med. Hyg. 28:1‐3.
   Sanni, L.A., Fonseca, L.F., and Langhorne, J., 2002. Mouse models for erythrocytic‐stage malaria. In Malaria Methods and Protocols. (D.L. Doolan, ed.). Humana Press, New Jersey.
   Shear, H.L., Nussenzweig, R.S., and Bianco, C. 1979. Immune phagocytosis in murine malaria. J. Exp. Med. 149:1288‐1298
   Stephens, R., Albano, F.R., Quin, S., Pascal, B.J., Harrison, V., Stockinger, B., Kioussis, D., Weltzein, H‐U., and Langhorne, J. 2005. Malaria‐specific transgenic CD4+ T cells protect immunodeficient mice from lethal infection and demonstrate requirement for a protective threshold of antibody production for parasite clearance. Blood 106:1676‐1684.
   Süss, G., Eichmann, K., Kury, E., Linke, A., and Langhorne, J. 1988. Role of CD4‐ and CD8‐bearing T lymphocytes in the immune response to the erythrocytic stages of Plasmodium chabaudi. Infect. Immun. 56:3081‐3088.
   Taylor‐Robinson, A.W. and Phillips, R.S. 1993. Protective CD4+ T‐cell lines raised against Plasmodium chabaudi show characteristics of either Th1 or Th2 cells. Parasite Immunol. 15:301‐310.
   Taylor‐Robinson, A.W., Phillips, R.S., Severn, A., Moncada, S., and Liew, F.Y. 1993. The role of Th1 and Th2 cells in rodent malaria infection. Science 260:1931‐1934.
   Taylor‐Robinson, A.W. and Phillips, R.S. 1994. Th1 and Th2 CD4+ T cell clones specific for Plasmodium chabaudi but not for an unrelated antigen protect against blood stage P. chabaudi infection. Eur. J. Immunol. 1:158‐164.
   Tian, J‐H., Miller, L.H., Kaslow, D.C., Ahlers, J., Good, M.F., Alling, D.W., Berzofsky, J.A., and Kumar, S. 1996. Genetic regulation of protective immune response in congenic strains of mice vaccinated with a subunit malaria vaccine. J. Immunol. 157:1176‐1183.
   van der Heyde, H.C., Huszar, D., Woodhouse, C., Manning, D.D., and Weidanz, W.P. 1994. The resolution of acute malaria in a definitive model of B cell deficiency, the JHD mouse. J. Immunol. 152:4557‐4562.
   van der Heyde, H.C., Elloso, M.M., Chang, W‐L., Kaplan, M., Manning, D.D., and Weidanz, W.P. 1995. γδ T cells function in cell‐mediated immunity to acute blood stage Plasmodium chabaudi adami malaria. J. Immunol. 154:3985‐3990.
   van der Heyde, H.C., Nolan, J., Combes, V., Gramaglia, I., and Grau, G.E. 2006. A unified hypothesis for the genesis of cerebral malaria: Sequestration, inflammation and hemostasis leading to microcirculatory dysfunction. Trends Parasitol. 22:503‐508.
   Varro, R., Chen, R., Sepulveda, H., and Apgar, J. 2007. Bead‐based multianalyte flow immunoassays: The cytometric bead array system. Methods Mol. Biol. 378:125‐152.
   Vinetz, J.M., Kumar, S., Good, M.F., Fowlkes, B.J., Berzofsky, J.A., and Miller, L.H. 1990. Adoptive transfer of CD8+ T cells from immune animals does not transfer immunity to blood stage Plasmodium yoelii malaria. J. Immunol. 144:1069‐1074.
   Waki, S., Uehara, S., Kanbe, K., Nariuch, H., and Suzuki, M. 1995. Interferon‐gamma and the induction of protective IgG2a antibodies in non‐lethal Plasmodium berghei infections of mice. Parasite Immunol. 17:503‐508.
   Weidanz, W.P. and Long, C.A. 1988. The role of T cells in immunity to malaria. Prog. Allergy 41:215‐252.
   Yanez, D.M., Manning, D.D., Cooley, A.J., Weidanz, W.P., and van der Heyde, H.C. 1996. Participation of lymphocyte subpopulations in the pathogenesis of experimental murine cerebral malaria. J. Immunol. 157:1620‐1624.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library