Mouse Model for Pre‐Clinical Study of Human Cancer Immunotherapy

Zhiya Ya1, Yared Hailemichael2, Willem Overwijk2, Nicholas P. Restifo1

1 National Cancer Institute, Surgery Branch, Bethesda, Maryland, 2 Department of Melanoma Medical Oncology–Research, Division of Cancer Medicine, The University of Texas MD Anderson Cancer Center, Houston, Texas
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 20.1
DOI:  10.1002/0471142735.im2001s108
Online Posting Date:  February, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes protocols for developing tumors in mice, including subcutaneous growth, pulmonary metastases of B16 melanoma, and spontaneous melanoma in B‐Raf V600E/PTEN deletion transgenic mouse models. Two immunization methods to prevent B16 tumor growth are described using B16.GM‐CSF and recombinant vaccinia virus. A therapeutic approach is also included that uses adoptive transfer of tumor antigen–specific T cells. Methods including CTL induction, isolation, testing, and genetic modification of mouse T cells for adoptive transfer by using retrovirus‐expressing genes of interest are provided. Additional sections, including growing B16 melanoma, enumerating pulmonary metastases, tumor imaging technique, and use of recombinant viruses for vaccination, are discussed together with safety concerns. © 2015 by John Wiley & Sons, Inc.

Keywords: B16 melanoma; translational cancer immunotherapy; tumor imaging; use of recombinant viruses for vaccination

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Mouse Model of Subcutaneous Tumor
  • Basic Protocol 2: Mouse Model of Multiple Pulmonary Tumor Metastases
  • Basic Protocol 3: Induction of Spontaneous Tumor in Transgenic Mice
  • Basic Protocol 4: Tumor Protection Using GM‐CSF‐Transduced Whole‐Cell Vaccine (B16.GM‐CSF)
  • Basic Protocol 5: Induction of B16 Melanoma Protection by Recombinant Vaccinia Virus (rVV) Vaccine
  • Basic Protocol 6: Adoptive Transfer of Tumor Antigen–Specific T Cells to Treat Established Tumor
  • Basic Protocol 7: Cloning HLA‐Restricted Antigen‐Specific T Cell Receptors for Clinical Use
  • Support Protocol 1: Growing B16 Melanoma
  • Support Protocol 2: Enumerating Pulmonary Metastases in Mice With B16 Melanoma
  • Support Protocol 3: Bioimaging of Luciferase‐Expressing Tumor In Vivo
  • Support Protocol 4: Immunization With rVV, rFPV, OR rAd
  • Support Protocol 5: Detecting Antibodies Against B16 Melanocyte Differentiation Antigens (MDA) by ELISA
  • Support Protocol 6: Generating B16 Melanoma‐Specific T Cell Cultures
  • Support Protocol 7: Functional Testing of B16 Melanoma–Specific T Cells
  • Support Protocol 8: Maintaining B16‐Specific CTL Cultures
  • Support Protocol 9: Culturing PMEL‐1 Transgenic T Cells
  • Support Protocol 10: Gene Modification of Mouse T Cells by γ‐Retroviral Transduction
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Mouse Model of Subcutaneous Tumor

  Materials
  • B16 culture, 50% to 80% confluent (see protocol 8)
  • Phosphate buffered saline (PBS, Life Technologies) or Hanks’ balanced salt solution (HBSS, Life Technologies)
  • 6‐ to 12‐week‐old female C57BL/6 mice
  • 70% isopropyl alcohol prep (Webcol, Kendall Healthcare)
  • 50‐ml conical centrifuge tubes
  • Refrigerated centrifuge, e.g., Sorvall RC4
  • 100‐μm disposable cell strainer (Falcon)
  • Hair clipper (Wahl, Model 8761)
  • 1‐ml disposable syringes and 27 G, ½‐in. needles
  • Calipers
  • Additional reagents and equipment for counting cells in a hemacytometer ( appendix 3A; Strober, , and determining viability by trypan blue exclusion ( appendix 3B; Strober, ), restraint of mice (unit 1.3; Donovan and Brown, ), ear tagging (unit 1.5; Donovan and Brown, ), and subcutaneous injection of mice (unit 1.6; Donovan and Brown, )

Basic Protocol 2: Mouse Model of Multiple Pulmonary Tumor Metastases

  Materials
  • B16 culture, 50% to 80% confluent (see protocol 8)
  • PBS or HBSS (Life Technologies)
  • 6‐ to 12‐week old female C57BL/6 mice
  • 100‐μm cell strainer (BD Falcon)
  • Heat lamp
  • 1‐ml disposable syringes and 27 G, ½ in. needles
  • Additional reagent s and equipment for preparing cell suspension ( protocol 1), counting cells in a hemacytometer ( appendix 3A; Strober, ), counting viable cells by trypan blue exclusion ( appendix 3B; Strober, ), restraint of mice (unit 1.3; Donovan and Brown, ), ear tagging (unit 1.5; Donovan and Brown, ), intravenous injections (unit 1.6; Donovan and Brown, ), euthanasia of mice (unit 1.8; Donovan and Brown, ), and enumeration of lung metastases ( protocol 9)

Basic Protocol 3: Induction of Spontaneous Tumor in Transgenic Mice

  Materials
  • 4‐hydroxytamoxifen (4‐HT, > 70% z‐isomer; Sigma),
  • Dimethylsulfoxide (DMSO, Sigma)
  • 4‐ to 5‐week‐old Tyr:CreERT2/BRAFhV600E CA/CA/PTEN flox/flox transgenic mice
  • Nair hair remover
  • Brown‐colored non‐transparent microcentrifuge tubes
  • Hair clipper (Wahl, Model 8761)
  • Sterile swabs
  • Fine‐tip paint brush
  • Calipers

Basic Protocol 4: Tumor Protection Using GM‐CSF‐Transduced Whole‐Cell Vaccine (B16.GM‐CSF)

  Materials
  • B16.GM‐CSF culture, 50% to 80% confluent (see protocol 8; procedure for preparing these cells is the same as for the B16 cells used in protocol 1)
  • PBS or HBSS (Life Technologies), ice cold
  • 6‐ to 12‐week old female C57BL/6 mice
  • Wild‐type B16.F10 culture (ATCC, cat. no. CRL‐6475), 50% to 80% confluent ( protocol 8)
  • γ irradiator
  • Calipers
  • Additional reagents and equipment for preparing cell suspension ( protocol 1, steps 1 to 8), injection of cell suspension into mice ( protocol 1, steps 11 to 16), and ear tagging (unit 1.5; Donovan and Brown, )

Basic Protocol 5: Induction of B16 Melanoma Protection by Recombinant Vaccinia Virus (rVV) Vaccine

  Materials
  • 6‐ to 12‐week old female C57BL/6 mice
  • rVVmTRP‐1 and control rVV encoding an irrelevant antigen (available from the authors; contact Dr. Nicholas Restifo at the Surgery Branch, NCI, NIH), prepared for intravenous injection ( protocol 11)
  • Wild‐type B16.F10 culture, 50% to 80% confluent ( protocol 8)
  • Additional reagents and equipment for immunization of mice with recombinant viral vectors (see protocol 11), subcutaneous challenge with B16 cells ( protocol 1), and ELISA detection of antibodies against MDA ( protocol 12)

Basic Protocol 6: Adoptive Transfer of Tumor Antigen–Specific T Cells to Treat Established Tumor

  Materials
  • T cells in 24‐well plates (see Support Protocols protocol 136 to protocol 169)
  • PBS or HBSS (Life Technologies), ice cold
  • Tumor‐bearing mice (Basic Protocols protocol 11 to protocol 33)
  • Recombinant viral vaccines (optional; see protocol 5)
  • Recombinant human IL‐2 (optional)
  • Multichannel pipettor with 1000 μl (P‐1000) pipet tips
  • 100‐ml reagent basins, sterile
  • 50‐ml conical centrifuge tubes
  • Refrigerated centrifuge (such as Sorvall RC4)
  • γ irradiator for small animals (optional)
  • Heat lamp
  • 3‐ml and 1‐ml disposable syringes with 27‐G, ½‐in. needles
  • Calipers
  • Additional reagents and equipment for counting cells in a hemacytometer ( appendix 3A; Strober, ) and determining viability by trypan blue exclusion ( appendix 3B; Strober, ), restraint of mice (unit 1.3; Donovan and Brown, ), ear tagging (unit 1.5; Donovan and Brown, ), intraperitoneal injection of mice (unit 1.6; Donovan and Brown, ), euthanasia by CO 2 asphyxiation (unit 1.8; Donovan and Brown, ), bioimaging ( protocol 10), and enumerating tumor nodules ( protocol 9)

Basic Protocol 7: Cloning HLA‐Restricted Antigen‐Specific T Cell Receptors for Clinical Use

  Materials
  • Peptide of interest or recombinant viral vaccines (see protocol 5 for the vaccines)
  • HBV‐core helper peptide 128‐140: TPPAYRPPNAPIL (a PAN MCH class II helper peptide)
  • DSMO (Sigma)
  • Sterile HBSS or PBS (Life Technologies)
  • Incomplete Freund's adjuvant (Sigma)
  • 6‐ to 8‐week old female HLA transgenic mice (some HLA transgenic mice are commercially available from The Jackson Laboratory or Taconic)
  • Complete medium (CM; see recipe)
  • Ultrapure lipopolysaccharide (LPS) from E. coli 0111:B4 strain (InVivogen), prepared at 5 mg/ml in sterile water according to manufacturer's manual.
  • Recombinant human IL‐2
  • Target cells for testing antigen specificity (see annotation to step 16, below)
  • Peptide/HLA tetramers (custom‐made at NIH Tetramer Core Facility, Emory University, Atlanta, Ga)
  • FACS buffer (see recipe)
  • RNAlater solution (Life Technologies)
  • RNeasy Mini Kit (Qiagen)
  • SMART cDNA synthesis kit (Clontech)
  • SMARTer RACE kit (Clontech)
  • Gene‐specific primers for mouse T cell receptor: α‐chain ggctactttcagcaggagga, β‐chain aggcctctgcactgatgttc
  • 1.2% agarose gel with ethidium bromide (unit 10.4; Voytas, )
  • Zymoclean Gel DNA recovery kit (Zymo Research)
  • TA cloning kit (Life Technologies)
  • TOP 10 E. coli (Invitrogen)
  • LB liquid medium and LB agar plates (e.g., unit 2.17; Baral et al., )
  • Appropriate selection antibiotic
  • Plasmid DNA Miniprep kit (Qiagen)
  • DNA sequencing facility
  • GeneArt Gene synthesis service (Life Technologies)
  • MSGV1 retroviral vector with a linker sequence encoding the foot and mouth disease picornavirus 2A “self‐cleaving” site separating the two (available from the authors; contact Dr. Nicholas Restifo at the Surgery Branch, NCI, NIH)
  • 24‐ and 48‐well culture plates
  • Dremel MultiPro 3955 variable speed kit with a 1/8‐in. drill
  • 1‐ml syringes
  • 19‐G and 27‐G, ½‐in. needles
  • 70% isopropyl alcohol prep (Webcol; Kendall Healthcare)
  • 162‐cm2 tissue culture coated flasks
  • 50‐ml conical tubes
  • Sterile dissecting tools
  • γ irradiator
  • FACS tubes
  • 96‐well round‐bottom plates
  • Additional reagents and equipment for footpad injection of (Donovan and Brown, ), subcutaneous injection of mice ( protocol 1), preparation of single‐cell suspension from mouse spleens ( protocol 13), euthanasia of mice (unit 1.8; Donovan and Brown, ), counting cells in a hemacytometer ( appendix 3A; Strober, 1997), determining viability by trypan blue exclusion ( appendix 3B; Strober, ), FACS (Chapter 5 in this manual), antigen‐specific IFN‐γ production ( protocol 14; optional), and agarose gel electrophoresis (unit 10.4; Voytas, )

Support Protocol 1: Growing B16 Melanoma

  Materials
  • Cryopreserved vial of B16.F10 (ATCC, cat. no. CRL‐6475; or other B16 line, e.g., B16.GM‐CSF)
  • DMEM medium (see recipe), ice cold
  • 15‐ml conical centrifuge tubes (e.g., BD Falcon)
  • Refrigerated centrifuge (such as Sorvall RC4)
  • 162‐cm2 tissue culture–coated flasks
  • Additional reagents and equipment for counting cells using a hemacytometer ( appendix 3A; Strober, ) and determining viable cells by trypan blue exclusion ( appendix 3B; Strober, )

Support Protocol 2: Enumerating Pulmonary Metastases in Mice With B16 Melanoma

  Materials
  • B16‐injected mice (see protocol 2)
  • Fekete's solution (see recipe)
  • Hardboard plate and pins
  • Sterile dissecting tools
  • Glass scintillation vials (PGC Scientifics)
  • Additional reagents and equipment for ear tagging (unit 1.5; Donovan and Brown, ) and euthanasia by CO 2 asphyxiation (unit 1.8; Donovan and Brown, )

Support Protocol 3: Bioimaging of Luciferase‐Expressing Tumor In Vivo

  Materials
  • D‐luciferin substrate (Caliper Life Sciences)
  • Mice with luciferase‐expressing tumors (retroviral vectors for preparing these mice are available from Dr. W. Overwijk)
  • 70% isopropyl alcohol prep (Webcol; Kendall Healthcare)
  • Dulbecco's PBS, without Ca++ and Mg++ (CMF‐DPBS, Life Technologies)
  • Isoflurane
  • 1‐ml syringes
  • 27‐G, ½‐in. needle
  • XGI‐8 Gas Anesthesia System (Caliper Life Sciences)
  • IVIS 200 Pre‐clinical In Vivo Imaging System (Caliper Life Sciences)
  • Living Image software (Caliper Life Sciences)

Support Protocol 4: Immunization With rVV, rFPV, OR rAd

  Materials
  • rVV or rFPV stock at a titer > 1 × 109 pfu/ml, or rAD at a titer > 1 × 1010 pfu/ml
  • PBS (Life Technologies), ice cold
  • 6‐ to 12‐week old female C57BL/6 mice
  • Cup sonicator filled with ice water
  • Heat lamp
  • 1‐ml disposable syringes and 27‐G, ½‐in. needles
  • Additional reagents and equipment for mouse restraint (unit 1.3; Donovan and Brown, ), ear tagging (unit 1.5; Donovan and Brown, ), and intravenous injection of mice (unit 1.6; Donovan and Brown, )

Support Protocol 5: Detecting Antibodies Against B16 Melanocyte Differentiation Antigens (MDA) by ELISA

  Materials
  • B16 culture
  • PBS (Life Technologies), ice cold
  • Liquid N 2
  • 1% and 5% (w/v) BSA in PBS (Life Technologies)
  • Sera from immunized mice
  • HRP‐conjugated anti‐mouse Ig (Amersham Pharmacia Biotech)
  • TMB substrate (Life Technologies)
  • 4 M H 2SO 4
  • Disposable cell scraper
  • Refrigerated centrifuge
  • Vacuum aspirator
  • Freeze‐resistant tubes
  • PVC microtiter plates (Dynex Technologies)
  • SkanWasher 300 (Skatron Instruments)
  • ELISA reader
  • Additional reagents and equipment for counting viable cells ( appendix 3A & Strober, , b)

Support Protocol 6: Generating B16 Melanoma‐Specific T Cell Cultures

  Materials
  • Immunized mice, at least 2 mice per group (see Basic Protocols protocol 33 and protocol 44)
  • HBSS (Life Technologies), ice cold
  • ACK Lysing buffer (Life Technologies)
  • Complete medium (CM;see recipe), ice cold
  • Peptide stocks: 10 mg/ml in DMSO
  • Sterile dissecting instruments
  • 70% isopropyl alcohol in spray bottle
  • 100‐μm sterile disposable cell strainers (BD Biosciences)
  • 3‐ml syringe
  • 50‐ml conical tubes (e.g., BD Falcon)
  • Refrigerated centrifuge (such as Sorvall RC4)
  • 25‐cm2 tissue culture flasks
  • Additional reagents and equipment for euthanasia of mice (unit 1.8; Donovan and Brown, ) and counting viable cells ( appendix 3A & ; Strober, , b)

Support Protocol 7: Functional Testing of B16 Melanoma–Specific T Cells

  Materials
  • B16‐specific CTL bulk culture (see protocol 13)
  • Culture medium (CM; see recipe)
  • Target cells, including B16 and control tumor cell lines
  • 10 mg/ml peptide stock in DMSO
  • IFN‐γ ELISA kit
  • Sterile reagent basins
  • 50‐ml conical tubes
  • Refrigerated centrifuge (such as Sorvall RC4)
  • 96‐well round‐bottom plates
  • Additional reagents and equipment for counting cells in a hemacytometer ( appendix 3A; Strober, ) and determining viability by trypan blue exclusion ( appendix 3B; Strober, )

Support Protocol 8: Maintaining B16‐Specific CTL Cultures

  Materials
  • B16‐specfic CTL (see protocol 13)
  • Complete medium (CM; see recipe), ice cold
  • Recombinant human IL‐2
  • 6‐ to 12‐week old female C57BL/6 mice
  • 10 mg/ml peptide in DMSO
  • 24‐well plates
  • γ irradiator
  • 50‐ml conical tubes
  • Additional reagents and equipment for counting cells in a hemacytometer ( appendix 3A; Strober, ), determination of viable cells by trypan blue exclusion ( appendix 3B; Strober, ), isolation of splenocytes ( protocol 13, steps 1 to 8), and CO 2 euthanasia (unit 1.8; Donovan and Brown, )

Support Protocol 9: Culturing PMEL‐1 Transgenic T Cells

  Materials
  • 6‐ to 8‐week old Pmel‐1 transgenic mice (Jackson Laboratory)
  • Complete medium (CM; see recipe)
  • Recombinant human IL‐2
  • 10 mg/ml gp100 25‐33 peptide stock (CPC Scientific, cat. no. 834139) in DMSO
  • 24‐well plates
  • Multi‐channel pipettor with 1200‐μl pipet tips
  • Additional reagents and equipment for isolation of splenocytes ( protocol 13, steps 1 to 8)

Support Protocol 10: Gene Modification of Mouse T Cells by γ‐Retroviral Transduction

  Materials
  • Platinum‐E retroviral packaging cell line ecotropic, (Plat‐E, Cell Biolabs Inc.) or other 293 based retroviral packaging cell line such as 293‐GP
  • DMEM medium, with and without antibiotics (see recipe)
  • Opti‐MEM medium (Life Technologies)
  • Retroviral vector (see protocol introduction)
  • Envelope vector such as pCL‐eco (Addgene, cat. no. 12371) for ecotropic retroviral production
  • Lipofectamine 2000 (Life Technologies)
  • Complete medium (see recipe)
  • Recombinant human IL‐2
  • Concanavalin A (ConA, Sigma)
  • Recombinant murine IL‐7
  • Phosphate‐buffered saline (PBS, Life Technologies), sterile
  • RetroNectin (Clontech), prepared at 1 mg/ml in sterile water according to the manufacturer's instruction
  • Protamine sulfate (optional; as an alternative to RetroNectin)
  • 2% (w/v) bovine serum albumin in PBS, sterile filtered
  • 100‐mm poly‐D‐lysine coated tissue culture dish (BioCoat; Corning, cat. no. 356469)
  • 3‐ml polypropylene tubes, sterile
  • 24‐well tissue culture plates
  • 24‐well non–tissue culture treated plates
  • 20‐ml syringes
  • 0.45‐μm filters
  • 15‐ml conical centrifuge tubes
  • Refrigerated centrifuge with biohazard‐protection‐covered rotor buckets adapted for tissue culture plates.
  • Additional reagents and equipment for counting cells viable cells in a hemacytometer by trypan blue exclusion ( appendix 3A & ; Strober, , b), and harvest of splenocytes ( protocol 11, steps 1 to 8)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aguirre, A.J., Bardeesy, N., Sinha, M., Lopez, L., Tuveson, D.A., Horner, J., Redston, M.S., and DePinho, R.A. 2003. Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic pancreatic ductal adenocarcinoma. Genes Dev. 24:3112‐3126.
  Baral, T.N., MacKenzie, R., and Arbabi Ghahroudi, M. 2013. Single‐domain antibodies and their utility. Curr. Protoc. Immunol. 103:2.17.1–2.17.57.
  Bloom, M.B., Perry‐Lalley, D., Robbins, P.F., Li, Y., El Gamil, M., Rosenberg, S.A., and Yang, J.C. 1997. Identification of tyrosinase‐related protein 2 as a tumor rejection antigen for the B16 melanoma. J. Exp. Med. 3:453‐459.
  Bohm, W., Thoma, S., Leithauser, F., Moller, P., Schirmbeck, R., and Reimann, J. 1998. T cell‐mediated, IFN‐gamma‐facilitated rejection of murine B16 melanomas. J. Immunol. 2:897‐908.
  Brahmer, J.R., Tykodi, S.S., Chow, L.Q., Hwu, W.J., Topalian, S.L., Hwu, P., Drake, C.G., Camacho, L.H., Kauh, J., Odunsi, K., Pitot, H.C., Hamid, O., Bhatia, S., Martins, R., Eaton, K., Chen, S., Salay, T.M., Alaparthy, S., Grosso, J.F., Korman, A.J., Parker, S.M., Agrawal, S., Goldberg, S.M., Pardoll, D.M., Gupta, A., and Wigginton, J.M. 2012. Safety and activity of anti‐PD‐L1 antibody in patients with advanced cancer. N. Engl. J. Med. 26:2455‐2465.
  Bronte, V., Apolloni, E., Ronca, R., Zamboni, P., Overwijk, W.W., Surman, D.R., Restifo, N.P., and Zanovello, P. 2000. Genetic vaccination with “self” tyrosinase‐related protein 2 causes melanoma eradication but not vitiligo. Cancer Res. 2:253‐258.
  Chen, L., McGowan, P., Ashe, S., Johnston, J., Li, Y., Hellstrom, I., and Hellstrom, K.E. 1994. Tumor immunogenicity determines the effect of B7 costimulation on T cell‐mediated tumor immunity. J. Exp. Med. 2:523‐532.
  Chin, L., Pomerantz, J., Polsky, D., Jacobson, M., Cohen, C., Cordon‐Cardo, C., Horner, J.W., and DePinho, R.A. 1997. Cooperative effects of INK4a and ras in melanoma susceptibility in vivo. Genes Dev. 21:2822‐2834.
  Chinnasamy, D., Yu, Z., Theoret, M.R., Zhao, Y., Shrimali, R.K., Morgan, R.A., Feldman, S.A., Restifo, N.P., and Rosenberg, S.A. 2010. Gene therapy using genetically modified lymphocytes targeting VEGFR‐2 inhibits the growth of vascularized syngenic tumors in mice. J. Clin. Invest. 11:3953‐3968.
  Chinnasamy, N., Wargo, J.A., Yu, Z., Rao, M., Frankel, T.L., Riley, J.P., Hong, J.J., Parkhurst, M.R., Feldman, S.A., Schrump, D.S., Restifo, N.P., Robbins, P.F., Rosenberg, S.A., and Morgan, R.A. 2011. A TCR targeting the HLA‐A*0201‐restricted epitope of MAGE‐A3 recognizes multiple epitopes of the MAGE‐A antigen superfamily in several types of cancer. J. Immunol. 2:685‐696.
  Colella, T.A., Bullock, T.N., Russell, L.B., Mullins, D.W., Overwijk, W.W., Luckey, C.J., Pierce, R.A., Restifo, N.P., and Engelhard, V.H. 2000. Self‐tolerance to the murine homologue of a tyrosinase‐derived melanoma antigen: Implications for tumor immunotherapy. J. Exp. Med. 7:1221‐1232.
  Conlon, K.C., Lugli, E., Welles, H.C., Rosenberg, S.A., Fojo, A.T., Morris, J.C., Fleisher, T.A., Dubois, S.P., Perera, L.P., Stewart, D.M., Goldman, C.K., Bryant, B.R., Decker, J.M., Chen, J., Worthy, T.A., Figg, W.D. Sr., Peer, C.J., Sneller, M.C., Lane, H.C., Yovandich, J.L., Creekmore, S.P., Roederer, M., and Waldmann, T.A. 2014. Redistribution, hyperproliferation, activation of natural killer cells and CD8 T cells, and cytokine production during first‐in‐human clinical trial of recombinant human interleukin‐15 in patients with cancer. J. Clin. Oncol. pii:JCO.2014.57.3329 [Epub ahead of print].
  Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery, C.A. Jr., Butel, J.S., and Bradley, A. 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 6366:215‐221.
  Donovan, J. and Brown, P. 2006a. Handling and restraint. Curr. Protoc. Immunol. 73:1.3.1‐1.3.6.
  Donovan, J. and Brown, P. 2006b. Animal identification. Curr. Protoc. Immunol. 73:1.5.1‐1.5.4.
  Donovan, J. and Brown, P. 2006c. Parenteral injections. Curr. Protoc. Immunol. 73:1.6.1‐1.6.10.
  Donovan, J. and Brown, P. 2006d. Euthanasia. Curr. Protoc. Immunol. 73:1.8.1‐1.8.4.
  Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., Pardoll, D., and Mulligan, R.C. 1993. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte‐macrophage colony‐stimulating factor stimulates potent, specific, and long‐lasting anti‐tumor immunity. Proc. Natl. Acad. Sci. U.S.A. 8:3539‐3543.
  Dudda, J.C., Salaun, B., Ji, Y., Palmer, D.C., Monnot, G.C., Merck, E., Boudousquie, C., Utzschneider, D.T., Escobar, T.M., Perret, R., Muljo, S.A., Hebeisen, M., Rufer, N., Zehn, D., Donda, A., Restifo, N.P., Held, W., Gattinoni, L., and Romero, P. 2013. MicroRNA‐155 is required for effector CD8+ T cell responses to virus infection and cancer. Immunity 4:742‐753.
  Dudley, M.E. and Rosenberg, S.A. 2003. Adoptive‐cell‐transfer therapy for the treatment of patients with cancer. Nat. Rev. Cancer 9:666‐675.
  Dudley, M.E., Wunderlich, J.R., Robbins, P.F., Yang, J.C., Hwu, P., Schwartzentruber, D.J., Topalian, S.L., Sherry, R., Restifo, N.P., Hubicki, A.M., Robinson, M.R., Raffeld, M., Duray, P., Seipp, C.A., Rogers‐Freezer, L., Morton, K.E., Mavroukakis, S.A., White, D.E., and Rosenberg, S.A. 2002. Cancer regression and autoimmunity in patients after clonal repopulation with antitumor lymphocytes. Science 5594:850‐854.
  Dudley, M.E., Yang, J.C., Sherry, R., Hughes, M.S., Royal, R., Kammula, U., Robbins, P.F., Huang, J., Citrin, D.E., Leitman, S.F., Wunderlich, J., Restifo, N.P., Thomasian, A., Downey, S.G., Smith, F.O., Klapper, J., Morton, K., Laurencot, C., White, D.E., and Rosenberg, S.A. 2008. Adoptive cell therapy for patients with metastatic melanoma: Evaluation of intensive myeloablative chemoradiation preparative regimens. J. Clin. Oncol. 32:5233‐5239.
  Dudley, M.E., Gross, C.A., Langhan, M.M., Garcia, M.R., Sherry, R.M., Yang, J.C., Phan, G.Q., Kammula, U.S., Hughes, M.S., Citrin, D.E., Restifo, N.P., Wunderlich, J.R., Prieto, P.A., Hong, J.J., Langan, R.C., Zlott, D.A., Morton, K.E., White, D.E., Laurencot, C.M., and Rosenberg, S.A. 2010. CD8+ enriched “young” tumor infiltrating lymphocytes can mediate regression of metastatic melanoma. Clin. Cancer Res. 24:6122‐6131.
  Dyall, R., Bowne, W.B., Weber, L.W., LeMaoult, J., Szabo, P., Moroi, Y., Piskun, G., Lewis, J.J., Houghton, A.N., and Nikolic‐Zugic, J. 1998. Heteroclitic immunization induces tumor immunity. J. Exp. Med. 9:1553‐1561.
  Earl, P.L., Cooper, N., Wyatt, L., Moss, B., and Carroll, M.W. 1998. Curr. Protoc. Mol. Biol. 60:16.16.1‐16.16.19.
  Fidler, I.J. and Bucana, C. 1977. Mechanism of tumor cell resistance to lysis by syngeneic lymphocytes. Cancer Res. 11:3945‐3956.
  Fidler, I.J., Gersten, D.M., and Budmen, M.B. 1976. Characterization in vivo and in vitro of tumor cells selected for resistance to syngeneic lymphocyte‐mediated cytotoxicity. Cancer Res. 9:3160‐3165.
  Gattinoni, L., Finkelstein, S.E., Klebanoff, C.A., Antony, P.A., Palmer, D.C., Spiess, P.J., Hwang, L.N., Yu, Z., Wrzesinski, C., Heimann, D.M., Surh, C.D., Rosenberg, S.A., and Restifo, N.P. 2005. Removal of homeostatic cytokine sinks by lymphodepletion enhances the efficacy of adoptively transferred tumor‐specific CD8+ T cells. J. Exp. Med. 7:907‐912.
  Greenberg, N.M., DeMayo, F., Finegold, M.J., Medina, D., Tilley, W.D., Aspinall, J.O., Cunha, G.R., Donjacour, A.A., Matusik, R.J., and Rosen, J.M. 1995. Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. U.S.A. 8:3439‐3443.
  Hanahan, D. 1985. Heritable formation of pancreatic beta‐cell tumours in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 6015:115‐122.
  Hara, I., Takechi, Y., and Houghton, A.N. 1995. Implicating a role for immune recognition of self in tumor rejection: Passive immunization against the brown locus protein. J. Exp. Med. 5:1609‐1614.
  Hart, I.R. 1979. The selection and characterization of an invasive variant of the B16 melanoma. Am. J. Pathol. 3:587‐600.
  Hingorani, S.R., Wang, L., Multani, A.S., Combs, C., Deramaudt, T.B., Hruban, R.H., Rustgi, A.K., Chang, S., and Tuveson, D.A. 2005. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell 5:469‐483.
  Hinrichs, C.S., Borman, Z.A., Cassard, L., Gattinoni, L., Spolski, R., Yu, Z., Sanchez‐Perez, L., Muranski, P., Kern, S.J., Logun, C., Palmer, D.C., Ji, Y., Reger, R.N., Leonard, W.J., Danner, R.L., Rosenberg, S.A., and Restifo, N.P. 2009. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proc. Natl. Acad. Sci. U.S.A. 41:17469‐17474.
  Hughes, M.S., Yu, Y.Y., Dudley, M.E., Zheng, Z., Robbins, P.F., Li, Y., Wunderlich, J., Hawley, R.G., Moayeri, M., Rosenberg, S.A., and Morgan, R.A. 2005. Transfer of a TCR gene derived from a patient with a marked antitumor response conveys highly active T‐cell effector functions. Hum. Gene Ther. 4:457‐472.
  Hung, K., Hayashi, R., Lafond‐Walker, A., Lowenstein, C., Pardoll, D., and Levitsky, H. 1998. The central role of CD4(+) T cells in the antitumor immune response. J. Exp. Med. 12:2357‐2368.
  Irvine, K.R., Chamberlain, R.S., Shulman, E.P., Surman, D.R., Rosenberg, S.A., and Restifo, N.P. 1997. Enhancing efficacy of recombinant anticancer vaccines with prime/boost regimens that use two different vectors. J. Natl. Cancer Inst. 21:1595‐1601.
  Irvine, K.R., Parkhurst, M.R., Shulman, E.P., Tupesis, J.P., Custer, M., Touloukian, C.E., Robbins, P.F., Yafal, A.G., Greenhalgh, P., Sutmuller, R.P., Offringa, R., Rosenberg, S.A., and Restifo, N.P. 1999. Recombinant virus vaccination against “self” antigens using anchor‐fixed immunogens. Cancer Res. 11:2536‐2540.
  Johnson, L.A., Morgan, R.A., Dudley, M.E., Cassard, L., Yang, J.C., Hughes, M.S., Kammula, U.S., Royal, R.E., Sherry, R.M., Wunderlich, J.R., Lee, C.C., Restifo, N.P., Schwarz, S.L., Cogdill, A.P., Bishop, R.J., Kim, H., Brewer, C.C., Rudy, S.F., VanWaes, C., Davis, J.L., Mathur, A., Ripley, R.T., Nathan, D.A., Laurencot, C.M., and Rosenberg, S.A. 2009. Gene therapy with human and mouse T‐cell receptors mediates cancer regression and targets normal tissues expressing cognate antigen. Blood 3:535‐546.
  Kerkar, S.P., Muranski, P., Kaiser, A., Boni, A., Sanchez‐Perez, L., Yu, Z., Palmer, D.C., Reger, R.N., Borman, Z.A., Zhang, L., Morgan, R.A., Gattinoni, L., Rosenberg, S.A., Trinchieri, G., and Restifo, N.P. 2010. Tumor‐specific CD8+ T cells expressing interleukin‐12 eradicate established cancers in lymphodepleted hosts. Cancer Res. 17:6725‐6734.
  Klebanoff, C.A., Finkelstein, S.E., Surman, D.R., Lichtman, M.K., Gattinoni, L., Theoret, M.R., Grewal, N., Spiess, P.J., Antony, P.A., Palmer, D.C., Tagaya, Y., Rosenberg, S.A., Waldmann, T.A., and Restifo, N.P. 2004. IL‐15 enhances the in vivo antitumor activity of tumor‐reactive CD8+ T cells. Proc. Natl. Acad. Sci. U.S.A. 7:1969‐1974.
  Kochenderfer, J.N., Yu, Z., Frasheri, D., Restifo, N.P., and Rosenberg, S.A. 2010. Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells. Blood 19:3875‐3886.
  Kochenderfer, J.N., Dudley, M.E., Carpenter, R.O., Kassim, S.H., Rose, J.J., Telford, W.G., Hakim, F.T., Halverson, D.C., Fowler, D.H., Hardy, N.M., Mato, A.R., Hickstein, D.D., Gea‐Banacloche, J.C., Pavletic, S.Z., Sportes, C., Maric, I., Feldman, S.A., Hansen, B.G., Wilder, J.S., Blacklock‐Schuver, B., Jena, B., Bishop, M.R., Gress, R.E., and Rosenberg, S.A. 2013. Donor‐derived CD19‐targeted T cells cause regression of malignancy persisting after allogeneic hematopoietic stem cell transplantation. Blood 25:4129‐4139.
  Kruisbeek, A. M. 2000. Isolation of mouse mononuclear cells. Curr. Protoc. Immunol. 39:3.1.1‐3.1.5.
  Li, M., Xu, F., Muller, J., Hearing, V.J., and Gorelik, E. 1998. Ecotropic C‐type retrovirus of B16 melanoma and malignant transformation of normal melanocytes. Int. J. Cancer 3:430‐436.
  Lindsey, K.R., Gritz, L., Sherry, R., Abati, A., Fetsch, P.A., Goldfeder, L.C., Gonzales, M.I., Zinnack, K.A., Rogers‐Freezer, L., Haworth, L., Mavroukakis, S.A., White, D.E., Steinberg, S.M., Restifo, N.P., Panicali, D.L., Rosenberg, S.A., and Topalian, S.L. 2006. Evaluation of prime/boost regimens using recombinant poxvirus/tyrosinase vaccines for the treatment of patients with metastatic melanoma. Clin. Cancer Res. 8:2526‐2537.
  Morgan, R.A., Dudley, M.E., Wunderlich, J.R., Hughes, M.S., Yang, J.C., Sherry, R.M., Royal, R.E., Topalian, S.L., Kammula, U.S., Restifo, N.P., Zheng, Z., Nahvi, A., de Vries, C.R., Rogers‐Freezer, L.J., Mavroukakis, S.A., and Rosenberg, S.A. 2006. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 5796:126‐129.
  Morgan, R.A., Chinnasamy, N., Abate‐Daga, D., Gros, A., Robbins, P.F., Zheng, Z., Dudley, M.E., Feldman, S.A., Yang, J.C., Sherry, R.M., Phan, G.Q., Hughes, M.S., Kammula, U.S., Miller, A.D., Hessman, C.J., Stewart, A.A., Restifo, N.P., Quezado, M.M., Alimchandani, M., Rosenberg, A.Z., Nath, A., Wang, T., Bielekova, B., Wuest, S.C., Akula, N., McMahon, F.J., Wilde, S., Mosetter, B., Schendel, D.J., Laurencot, C.M., and Rosenberg, S.A. 2013. Cancer regression and neurological toxicity following anti‐MAGE‐A3 TCR gene therapy. J. Immunother. 2:133‐151.
  Muranski, P., Boni, A., Antony, P.A., Cassard, L., Irvine, K.R., Kaiser, A., Paulos, C.M., Palmer, D.C., Touloukian, C.E., Ptak, K., Gattinoni, L., Wrzesinski, C., Hinrichs, C.S., Kerstann, K.W., Feigenbaum, L., Chan, C.C., and Restifo, N.P. 2008. Tumor‐specific Th17‐polarized cells eradicate large established melanoma. Blood 2:362‐373.
  Naftzger, C., Takechi, Y., Kohda, H., Hara, I., Vijayasaradhi, S., and Houghton, A.N. 1996. Immune response to a differentiation antigen induced by altered antigen: A study of tumor rejection and autoimmunity. Proc. Natl. Acad. Sci. U.S.A. 25:14809‐14814.
  Otsuka, T., Takayama, H., Sharp, R., Celli, G., LaRochelle, W.J., Bottaro, D.P., Ellmore, N., Vieira, W., Owens, J.W., Anver, M., and Merlino, G. 1998. c‐Met autocrine activation induces development of malignant melanoma and acquisition of the metastatic phenotype. Cancer Res. 22:5157‐5167.
  Overwijk, W.W., Surman, D.R., Tsung, K., and Restifo, N.P. 1997. Identification of a Kb‐restricted CTL epitope of beta‐galactosidase: potential use in development of immunization protocols for “self” antigens. Methods 2:117‐123.
  Overwijk, W.W., Tsung, A., Irvine, K.R., Parkhurst, M.R., Goletz, T.J., Tsung, K., Carroll, M.W., Liu, C., Moss, B., Rosenberg, S.A., and Restifo, N.P. 1998. gp100/pmel 17 is a murine tumor rejection antigen: induction of “self”‐reactive, tumoricidal T cells using high‐affinity, altered peptide ligand. J. Exp. Med. 2:277‐286.
  Overwijk, W.W., Lee, D.S., Surman, D.R., Irvine, K.R., Touloukian, C.E., Chan, C.C., Carroll, M.W., Moss, B., Rosenberg, S.A., and Restifo, N.P. 1999a. Vaccination with a recombinant vaccinia virus encoding a “self” antigen induces autoimmune vitiligo and tumor cell destruction in mice: requirement for CD4(+) T lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 6:2982‐2987.
  Overwijk, W.W., Lee, D.S., Surman, D.R., Irvine, K.R., Touloukian, C.E., Chan, C.C., Carroll, M.W., Moss, B., Rosenberg, S.A., and Restifo, N.P. 1999b. Vaccination with a recombinant vaccinia virus encoding a “self” antigen induces autoimmune vitiligo and tumor cell destruction in mice: Requirement for CD4(+) T lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 6:2982‐2987.
  Overwijk, W.W., Theoret, M.R., Finkelstein, S.E., Surman, D.R., de Jong, L.A., Vyth‐Dreese, F.A., Dellemijn, T.A., Antony, P.A., Spiess, P.J., Palmer, D.C., Heimann, D.M., Klebanoff, C.A., Yu, Z., Hwang, L.N., Feigenbaum, L., Kruisbeek, A.M., Rosenberg, S.A., and Restifo, N.P. 2003. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self‐reactive CD8+ T cells. J. Exp. Med. 4:569‐580.
  Parkhurst, M.R., Joo, J., Riley, J.P., Yu, Z., Li, Y., Robbins, P.F., and Rosenberg, S.A. 2009. Characterization of genetically modified T‐cell receptors that recognize the CEA:691‐699 peptide in the context of HLA‐A2.1 on human colorectal cancer cells. Clin. Cancer Res. 1:169‐180.
  Parkhurst, M.R., Yang, J.C., Langan, R.C., Dudley, M.E., Nathan, D.A., Feldman, S.A., Davis, J.L., Morgan, R.A., Merino, M.J., Sherry, R.M., Hughes, M.S., Kammula, U.S., Phan, G.Q., Lim, R.M., Wank, S.A., Restifo, N.P., Robbins, P.F., Laurencot, C.M., and Rosenberg, S.A. 2011. T cells targeting carcinoembryonic antigen can mediate regression of metastatic colorectal cancer but induce severe transient colitis. Mol. Ther. 3:620‐626.
  Phan, G.Q. and Rosenberg, S.A. 2013. Adoptive cell transfer for patients with metastatic melanoma: The potential and promise of cancer immunotherapy. Cancer Control 4:289‐297.
  Phan, G.Q., Yang, J.C., Sherry, R.M., Hwu, P., Topalian, S.L., Schwartzentruber, D.J., Restifo, N.P., Haworth, L.R., Seipp, C.A., Freezer, L.J., Morton, K.E., Mavroukakis, S.A., Duray, P.H., Steinberg, S.M., Allison, J.P., Davis, T.A., and Rosenberg, S.A. 2003. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte‐associated antigen 4 blockade in patients with metastatic melanoma. Proc. Natl. Acad. Sci. U.S.A. 14:8372‐8377.
  Rabinovich, B.A., Ye, Y., Etto, T., Chen, J.Q., Levitsky, H.I., Overwijk, W.W., Cooper, L.J., Gelovani, J., and Hwu, P. 2008. Visualizing fewer than 10 mouse T cells with an enhanced firefly luciferase in immunocompetent mouse models of cancer. Proc. Natl. Acad. Sci. U.S.A. 38:14342‐14346.
  Robbins, P.F., Morgan, R.A., Feldman, S.A., Yang, J.C., Sherry, R.M., Dudley, M.E., Wunderlich, J.R., Nahvi, A.V., Helman, L.J., Mackall, C.L., Kammula, U.S., Hughes, M.S., Restifo, N.P., Raffeld, M., Lee, C.C., Levy, C.L., Li, Y.F., El Gamil, M., Schwarz, S.L., Laurencot, C., and Rosenberg, S.A. 2011. Tumor regression in patients with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes reactive with NY‐ESO‐1. J. Clin. Oncol. 7:917‐924.
  Rosenberg, S.A. 1999. A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 3:281‐287.
  Rosenberg, S.A., Spiess, P., and Lafreniere, R. 1986. A new approach to the adoptive immunotherapy of cancer with tumor‐infiltrating lymphocytes. Science 4770:1318‐1321.
  Rosenberg, S.A., Yang, J.C., Schwartzentruber, D.J., Hwu, P., Marincola, F.M., Topalian, S.L., Restifo, N.P., Dudley, M.E., Schwarz, S.L., Spiess, P.J., Wunderlich, J.R., Parkhurst, M.R., Kawakami, Y., Seipp, C.A., Einhorn, J.H., and White, D.E. 1998. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat. Med. 3:321‐327.
  Rosenberg, S.A., Yang, J.C., Schwartzentruber, D.J., Hwu, P., Topalian, S.L., Sherry, R.M., Restifo, N.P., Wunderlich, J.R., Seipp, C.A., Rogers‐Freezer, L., Morton, K.E., Mavroukakis, S.A., Gritz, L., Panicali, D.L., and White, D.E. 2003. Recombinant fowlpox viruses encoding the anchor‐modified gp100 melanoma antigen can generate antitumor immune responses in patients with metastatic melanoma. Clin. Cancer Res. 8:2973‐2980.
  Rosenberg, S.A., Restifo, N.P., Yang, J.C., Morgan, R.A., and Dudley, M.E. 2008. Adoptive cell transfer: A clinical path to effective cancer immunotherapy. Nat. Rev. Cancer 4:299‐308.
  Schwartzentruber, D.J., Lawson, D.H., Richards, J.M., Conry, R.M., Miller, D.M., Treisman, J., Gailani, F., Riley, L., Conlon, K., Pockaj, B., Kendra, K.L., White, R.L., Gonzalez, R., Kuzel, T.M., Curti, B., Leming, P.D., Whitman, E.D., Balkissoon, J., Reintgen, D.S., Kaufman, H., Marincola, F.M., Merino, M.J., Rosenberg, S.A., Choyke, P., Vena, D., and Hwu, P. 2011. gp100 peptide vaccine and interleukin‐2 in patients with advanced melanoma. N. Engl. J. Med. 22:2119‐2127.
  Small, E.J., Tchekmedyian, N.S., Rini, B.I., Fong, L., Lowy, I., and Allison, J.P. 2007. A pilot trial of CTLA‐4 blockade with human anti‐CTLA‐4 in patients with hormone‐refractory prostate cancer. Clin. Cancer Res. 6:1810‐1815.
  Stewart, T.A., Pattengale, P.K., and Leder, P. 1984. Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes. Cell 3:627‐637.
  Strober, W. 1997a. Monitoring cell growth. Curr. Protoc. Immunol. 21:3A.1‐A.3A.2.
  Strober, W. 1997b. Trypan blue exclusion test of cell viability. Curr. Protoc. Immunol. 21:A.3B.1–A.3B.2.
  Surman, D.R., Dudley, M.E., Overwijk, W.W., and Restifo, N.P. 2000. Cutting edge: CD4+ T cell control of CD8+ T cell reactivity to a model tumor antigen. J. Immunol. 2:562‐565.
  Topalian, S.L., Hodi, F.S., Brahmer, J.R., Gettinger, S.N., Smith, D.C., McDermott, D.F., Powderly, J.D., Carvajal, R.D., Sosman, J.A., Atkins, M.B., Leming, P.D., Spigel, D.R., Antonia, S.J., Horn, L., Drake, C.G., Pardoll, D.M., Chen, L., Sharfman, W.H., Anders, R.A., Taube, J.M., McMiller, T.L., Xu, H., Korman, A.J., Jure‐Kunkel, M., Agrawal, S., McDonald, D., Kollia, G.D., Gupta, A., Wigginton, J.M., and Sznol, M. 2012. Safety, activity, and immune correlates of anti‐PD‐1 antibody in cancer. N. Engl. J. Med. 26:2443‐2454.
  van Elsas, A., Hurwitz, A.A., and Allison, J.P. 1999a. Combination immunotherapy of B16 melanoma using anti‐cytotoxic T lymphocyte‐associated antigen 4 (CTLA‐4) and granulocyte/macrophage colony‐stimulating factor (GM‐CSF)‐producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J. Exp. Med. 3:355‐366.
  van Elsas, A., Hurwitz, A.A., and Allison, J.P. 1999b. Combination immunotherapy of B16 melanoma using anti‐cytotoxic T lymphocyte‐associated antigen 4 (CTLA‐4) and granulocyte/macrophage colony‐stimulating factor (GM‐CSF)‐producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J. Exp. Med. 3:355‐366.
  van Elsas, A., Sutmuller, R.P., Hurwitz, A.A., Ziskin, J., Villasenor, J., Medema, J.P., Overwijk, W.W., Restifo, N.P., Melief, C.J., Offringa, R., and Allison, J.P. 2001. Elucidating the autoimmune and antitumor effector mechanisms of a treatment based on cytotoxic T lymphocyte antigen‐4 blockade in combination with a B16 melanoma vaccine: Comparison of prophylaxis and therapy. J. Exp. Med. 4:481‐489.
  Voytas, D. 1991. Agarose gel electrophoresis. Curr. Protoc. Immunol. 2:10.4.1‐10.4.8.
  Weber, L.W., Bowne, W.B., Wolchok, J.D., Srinivasan, R., Qin, J., Moroi, Y., Clynes, R., Song, P., Lewis, J.J., and Houghton, A.N. 1998. Tumor immunity and autoimmunity induced by immunization with homologous DNA. J. Clin. Invest. 6:1258‐1264.
  Wrzesinski, C., Paulos, C.M., Gattinoni, L., Palmer, D.C., Kaiser, A., Yu, Z., Rosenberg, S.A., and Restifo, N.P. 2007. Hematopoietic stem cells promote the expansion and function of adoptively transferred antitumor CD8 T cells. J. Clin. Invest. 2:492‐501.
  Wrzesinski, C., Paulos, C.M., Kaiser, A., Muranski, P., Palmer, D.C., Gattinoni, L., Yu, Z., Rosenberg, S.A., and Restifo, N.P. 2010. Increased intensity lymphodepletion enhances tumor treatment efficacy of adoptively transferred tumor‐specific T cells. J. Immunother. 1:1‐7.
  Wu, T.C., Huang, A.Y., Jaffee, E.M., Levitsky, H.I., and Pardoll, D.M. 1995. A reassessment of the role of B7‐1 expression in tumor rejection. J. Exp. Med. 5:1415‐1421.
  Xu, F., Carlos, T., Li, M., Sanchez‐Sweatman, O., Khokha, R., and Gorelik, E. 1998. Inhibition of VLA‐4 and up‐regulation of TIMP‐1 expression in B16BL6 melanoma cells transfected with MHC class I genes. Clin. Exp. Metastasis 4:358‐370.
  Yu, Z., Theoret, M.R., Touloukian, C.E., Surman, D.R., Garman, S.C., Feigenbaum, L., Baxter, T.K., Baker, B.M., and Restifo, N.P. 2004. Poor immunogenicity of a self/tumor antigen derives from peptide‐MHC‐I instability and is independent of tolerance. J. Clin. Invest. 4:551‐559.
  Zeh, H.J. III, Perry‐Lalley, D., Dudley, M.E., Rosenberg, S.A., and Yang, J.C. 1999. High avidity CTLs for two self‐antigens demonstrate superior in vitro and in vivo antitumor efficacy. J. Immunol. 2:989‐994.
  Zhu, H., Reuhl, K., Zhang, X., Botha, R., Ryan, K., Wei, J., and Chen, S. 1998. Development of heritable melanoma in transgenic mice. J. Invest. Dermatol. 3:247‐252.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library