Differentiation of Multipotent Adult Progenitor Cells into Functional Endothelial and Smooth Muscle Cells

Aernout Luttun1, Jeffrey J. Ross1, Catherine Verfaillie1, Xabier L. Aranguren2, Felipe Prósper2

1 University of Minnesota, Minneapolis, Minnesota, 2 Clínica Universitaria University of Navarra, Pamplona
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 22F.9
DOI:  10.1002/0471142735.im22f09s75
Online Posting Date:  December, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Stem cells are not only a promising in vivo tool for the treatment of diseases characterized by irreversible tissue damage, but can also be exploited as in vitro systems to study the conditions required to generate molecularly and functionally defined cell types. Constructing functional arteries with luminal arterial endothelial cells stabilized by a medial layer of smooth muscle cells is one of the challenges of regenerative medicine. This unit describes the conditions for generating endothelial and smooth muscle cells from multipotent adult progenitor cells (MAPCs). It elaborates on the importance of certain parameters, e.g., quality control of the stem cell population used, serum lot variations, seeding density, use of appropriate cytokines, critical to obtaining high differentiation efficiencies. It further focuses on the molecular and functional characterization of the obtained cell types.

Keywords: stem cells; endothelial cells; smooth muscle cells; differentiation; culture; cytokines; functionality

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Strategic Planning
  • Basic Protocol 1: Endothelial Differentiation from Mouse, Rat, and Human MAPCs
  • Basic Protocol 2: Smooth Muscle Differentiation from Mouse, Rat, and Human MAPCs
  • Support Protocol 1: Small‐Scale Transcriptional Profiling of Differentiated SMCs and ECs
  • Support Protocol 2: Three‐Dimensional Tube Formation in Matrigel
  • Support Protocol 3: Testing of Remodeling Properties
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Endothelial Differentiation from Mouse, Rat, and Human MAPCs

  Materials
  • 1 µg/ml or 50 ng/ml fibronectin coating solution (see recipe)
  • Qualified MAPCs, rodent or human (see )
  • Phosphate‐buffered saline (PBS; appendix 2A2) without calcium or magnesium
  • 0.05% (w/v) trypsin (Cellgro, Mediatech)
  • MAPC growth medium: human, mouse, or rat (see reciperecipes)
  • Basal medium (see recipe)
  • MAPC endothelial differentiation medium: human, mouse, or rat (see reciperecipes)
  • 24‐well culture plates (Corning) or Lab‐Tek 4‐well glass multiplex chambers (Nunc)
  • Microscope
  • 50‐ml conical, polypropylene, screw‐cap centrifuge tubes (e.g., Falcon)
  • Refrigerated, low‐speed centrifuge
  • Hemacytometer
  • 37°C, O 2 control, humidified cell incubator with 5% CO 2, 5% O 2 for rodent cells or 5% CO 2, 20% O 2 for human cells

Basic Protocol 2: Smooth Muscle Differentiation from Mouse, Rat, and Human MAPCs

  • 100 ng/ml fibronectin coating solution (see recipe)
  • Smooth muscle differentiation medium (see recipe)
  • 10‐cm cell culture dishes (e.g., Nunc)

Support Protocol 1: Small‐Scale Transcriptional Profiling of Differentiated SMCs and ECs

  Materials
  • Differentiated cells ( protocol 1 or protocol 22 or protocol 5)
  • PBS ( appendix 22) without calcium or magnesium
  • 14.3 M 2‐mercaptoethanol (Sigma)
  • RNAmini preparation kit (Qiagen) including:
    • RLT buffer
    • Loading columns
    • Collector tubes
    • RW1 washing buffer
    • RPE buffer
    • Nuclease‐free water
  • 100% ethanol and 70% (v/v) ethanol: prepared using nuclease‐free water (Ambion) and molecular grade 100% ethanol
  • Dry ice
  • DNAse‐free kit (Ambion) including
    • 10× buffer
    • 2 U/µl DNase I
    • Inactivation reagent
    • Nuclease‐free water
  • Superscript II RNase first‐strand synthesis system for RT‐PCR (Invitrogen) including:
    • 10 mM dNTPs
    • 50 ng/µl random hexamers
    • 10× buffer
    • 25 mM MgCl 2
    • 0.1 M DTT
    • Nuclease‐free water
    • 50 U/µl reverse transcriptase
    • 40 U/µl RNaseOUT
    • 2 U/µl RNaseH
  • 100 µM primer stocks for housekeeping genes and genes of interest (see Table 22.9.1)
  • cDNAs for positive controls (see Table 22.9.1)
  • Sybr Green solution or probes (Applied Biosystems; see Table 22.9.1)
  • PCR mastermix (Invitrogen)
  • Nuclease‐free water (Ambion)
  • Separate designated sets of micropipettors for RNA and cDNA manipulation (recommended)
  • 1000‐µl, 200‐µl, and 10‐µl filter tips (Axygen)
  • 1.5‐ml and 0.2‐ml microcentrifuge tubes, nuclease free (with flat caps)
  • −80°C and −20°C freezers
  • Microcentrifuge
  • 37°C water bath or heating block
  • 96‐well PCR plates with cap strips
  • Spectrophotometer and quartz cuvettes
  • Thermocycler
  • Quantitative RT‐PCR machine (ABI Prism 7700) and software
    Table 2.0.1   Materials   Primers for Endothelial and Smooth Muscle Genes a   Primers for Endothelial and Smooth Muscle Genes

    Gene/protein name Primer sequence (5′‐3′) User concentration Positive control
    Primers for endothelial genes (general) b
    Flt‐1 (VEGFR‐1) F: CTGTGCGGAAATCTTCAAGTCA (M+R) R: CCTTGATCTCCTCTGTGGAGTTG (M+R) F: GGACTGACAGCAAACCCAAG (H) R: CAGCCCCGACTCCTTACTTT (H) 200 nM (M)/100 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    Flk‐1 (VEGFR‐2) F: TCTGTGGTTCTGCGTGGAGA (M) R: GTATCATTTCCAACCACCCT (M) F: CCAAGCTCAGCACACAAAAA (R) R: CCAACCACTCTGGGAACTGT (R) F: TCCTGTATGGAGGAGGAGGA (H) R: CGGCTCTTTCGCTTACTGTT (H) 100 nM (M); 200 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    PECAM (CD31) F: GTCATGGCCATGGTCGAGTA (M) R: CTCCTCGGCGATCTTGCTGAA (M) F: GGACTGGCCCTGTCACGTT (R) R: TTGTTCATGGTGCCAAAACACT (R) F: ACTGCACAGCCTTCAACAGA (H) R: TTTCTTCCATGGGGCAAG (H) 200 nM (M); 200 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    von Willebrand factor F: GCCAAAGATCTGGAACAGTGT (M) R: GATGGAGAGGTTACACATCTC (M) F: CCCACCGGATGGCTAGGTATT (R) R: GAGGCGGATCTGTTTGAGGTT (R) F: GTCGAGCTGCACAGTGACAT (H) R: CCACGTAAGGAACAGAGACCA (H) 400 nM (M); 400 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    VE‐cadherin F: ATTGAGACAGACCCCAAACG (M) R: TTCTGGTTTTCTGGCAGCTT (M) F: GGCCAACGAATTGGATTCTA (R) R: GTTTACTGGCACCACGTCCT (R) F: GTTCACGCATCGGTTGTTC (H) R: TCTGCATCCACTGCTGTCA (H) 200 nM (M); 200 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    Tie‐2 (Tek‐1) F: AAGACATACGTGAACACCAC (M) R: AGTCAGAACACACTGCAGAT (M) F: AACCAACAGTGATGTCTGGTCCTAT (R) R: GCACGTCATGCCGCAGTA (R) F: TGCCCAGATATTGGTGTCCT (H) R: CTCATAAAGCGTGGTATTCACGTA (H) 200 nM (M); 400 nM (R); 100 nM (H) MS‐I (M); Spleen (R); HUVEC (H)
    Primers for endothelial genes (subtype‐specific) c
    Eph‐B4 (venous) F: AATGTCACCACTGACCGTGA (M) R: TCAGGAAACGAACACTGCTG (M) F: GTTCCCTGGACTCCTTCCTC (R) R: GAGAGCCCGAAGTCAGACAC (R) F: GCCGCAGCTTTGGAAGAG (H) R: GGGAATGTCACCCACTTCAGA (H) PROBE: CCCTGCTGAACACAAAATTGG (H) 200 nM (M); 200 nM (R); 500 nM R and F; 250 nM probe (H) Spleen (M); Spleen (R); HUVEC (H)
    COUPTF‐II (venous) F: GACTCCGCCGAGTATAGCTG (M) R: CCTACCAAACGGACGAAAAA (M) F: CGCCTCAAAAAGTGCCTCA (H) R: GCATCCTGCCCCTCTGC (H) PROBE: AGTGGGCATGAGACGGGAAGCG (H) 200 nM (M); 500 nM R and F; 250 nM probe (H) Universal RNA (M+R); HUVEC (H)
    Ephrin‐B2 (arterial) F: ACAGGTGGGAGGTGACTGAC (M) R: GCTGCGCTTTTTATTTCCAG (M) F: TCCCTTTGTGAAGCCAAATC (R) R: GTCTCCTGCGGTACTTGAGC (R) F: CTCCTCAACTGTGCCAAACCA (H) R: GGTTATCCAGGCCCTCCAAA (H) PROBE: ACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTC (H) 200 nM (M); 200 nM (R); 500 nM R and F; 250 nM probe (H) MS‐1 (M); Spleen (R); Umbilical cord arterial ECs (H)
    Ephrin‐B1 (arterial) F: GTTCTCGACCCCAACGTGTT (H) R: CAGGCTTCCATTGGATGTTGA (H) PROBE: TCACCTGCAATAGGCCAGAGCAGGAAATAC (H) 500 nM R and F; 250 nM probe (H) Umbilical cord arterial ECs (H)
    Dll‐4 (arterial) F: ACCTTTGGCAATGTCTCCAC (M) R: GTTTCCTGGCGAAGTCTCTG (M) F: ACCTTTGGCAATGTCTCCAC (R) R: TTGGATGATGATTTGGCTGA (R) F: ATGACCACTTCGGCCACTATG (H) R: GCCCGAAAGACAGATAGGCTG (H) PROBE: TCCTGCCTGCCCGGTTGGAC (H) 100 nM (M); 200 nM (R); 500 nM R and F; 250 nM probe (H) MS‐1 (M); Rat aorta (R); Umbilical cord arterial ECs (H)
    Prox‐1 (lymphatic) F: GGAGATGGCTGAGAACAAGC (M+R) R: AGACTTTGACCACCGTGTCC (M+R) F: CAGTACTGAAGAGCTGTCTATAACCAGAG (H) R: TCTGAGCAACTTCCAGGAATCTC (H) PROBE: CTGTACAGGGCTCTGAACATGCACTACAATAAAGC (H) 100 nM (M)/200 nM (R); 500 nM R and F; 250 nM probe (H) Spleen (M); Spleen (R); Total RNA (H)
    LYVE‐1 (lymphatic) F: AGGAGCCCTCTCCTTACTGC (M+R) R: ACCTGGAAGCCTGTCTCTGA (M+R) F: CTTTGAAACTTGCAGCTATGGCT (H) R: TCAGGACACCCACCCCATT (H) PROBE: AGGATTAGCCCAAACCCCAAGTGTGG (H) 400 nM (M)/400 nM (R); 500 nM R and F; 250 nM probe (H) Spleen (M); Spleen (R); Total RNA (H)
    Primers for smooth muscle genes
    Smooth muscle actin CGCTGTCAGGAACCCTGAGA (M) CGAAGCCGGCCTTACAGA (M) CGCCATCAGGAACCTCGAGA (R) CAAAGCCCGCCTTACAGA (R) CACTGTCAGGAATCCTGTGA (H) CAAAGCCGGCCTTACAGA (H) 125 nM Intestinal SMCs (M); Aortic SMCs (R); Aortic SMCs (H)
    SM22 F; CCACAAACGACCAAGCCTTCT (M) R: CGGCTCATGCCGTAGGAT (M) F: CCACAAACGACCAAGCCTTTT (R) R: CGGCTCATGCCATAGGATG (R) F: GGCAGCTTGGCAGTGACC (H) R: TGGCTCTCTGTGAATTCCCTCT (H) 125 nM Intestinal SMCs (M); Aortic SMCs (R); Aortic SMCs (H)
    Calponin ACATCATTGGACTGCAGATG (M) CAAAGATCTGCCGCTTGGTG (M) ACATCATTGGCCTACAGATG (R) CAAAGATCTGCCGCTTGGTG (R) TTTTGAGGCCAACGACCTGT (H) TCCTTTCGTCTTCGCCATG (H) 125 nM Intestinal SMCs (M); Aortic SMCs (R); Aortic SMCs (H)
    Smooth muscle myosin heavy chain (SM1) TGGACACCATGTCAGGGAAA (M) ATGGACACAAGTGCTAAGCAGTCT (M) CAAGAGTTCCGGCAACGCTA (R) TCCATCCATGAAGCCTTTGG (R) CAGGAGTTCCGCCAACGCTA (H) TCCCGTCCATGAAGCCTTTGG (H) 125 nM Intestinal SMCs (M); Aortic SMCs (R); Aortic SMCs (H)
    Myocardin CTGTGTGGAGTCCTCAGGTCAAACC (M) GATGTGTTGCGGGCTCTTCAG (M) CTGTGTGGAGTCCTCAGGTCAAACC (R) GATGTGTTGCGGGCTCTTCAG (R) AACCAGGCCCACTCCCAC (H) CAGGCAAGCCCCGAATT (H) 125 nM Intestinal SMCs (M); Aortic SMCs (R); Aortic SMCs (H)
    Primers for housekeeping genes
    GAPDH F: TGCACCACCAACTGCTTAG (M+R) R: GATGCAGGGATGATGTTC (M+R) F: TGGTATCGTGGAAGGACTCATGAC (H) R: ATGCCAGTGAGCTTCCCGTTCAGC (H) PROBE: CCCAGAGACTGTGGATGGCCCC (H) 200 nM (M)/200 nM (R); 500 nM R and F; 250 nM probe (H) Corresponding to positive control of the gene of interest

     aAbbreviations: F, forward primer; R, reverse primer; M, mouse; R, rat; H, human; HUVEC, human umbilical vein endothelial cell.
     bSynonyms in parentheses.
     cEndothelial subtypes in parentheses.

Support Protocol 2: Three‐Dimensional Tube Formation in Matrigel

  Materials
  • MAPC‐ECs (differentiated MAPC endothelial cells; protocol 1)
  • PBS ( appendix 2A) without calcium or magnesium
  • 0.25% (w/v) trypsin (Cellgro, Mediatech)
  • Recombinant cytokine stock solutions (see recipe):
    • rh‐VEGF 165
    • rh‐b‐FGF
  • Matrigel aliquots (see recipe)
  • VEC complete medium (VEC Technologies)
  • 15‐ and 50‐ml conical, polypropylene, screw‐cap centrifuge tubes (e.g., Falcon)
  • 40‐µm cell filter (Becton Dickinson)
  • Refrigerated low‐speed centrifuge
  • Hemacytometer
  • 37°C, O 2 control, humidified cell incubator with 5% CO 2, 5% O 2 for rodent cells or 5% CO 2, 20% O 2 for human cells
  • 12‐well cell culture plates (Corning)
  • 1.5‐ml microcentrifuge tubes, sterile
  • Phase‐contrast microscope with camera

Support Protocol 3: Testing of Remodeling Properties

  • MAPC‐SMCs (differentiated MAPC smooth muscle cells; see protocol 2)
  • Smooth muscle expansion medium (see recipe)
  • Dulbecco's Modified Eagle Medium (DMEM; Gibco)
  • 0.25% (w/v) trypsin (Cellgro, Mediatech)
  • 4% paraformaldyhyde (PFA) in PBS ( appendix 2A)
  • 30% (w/v) sucrose in PBS
  • OCT compound (Tissue‐Tek)
  • 30 mg/ml fibrinogen stock (see recipe)
  • 250 U/ml thrombin stock (see recipe)
  • HEPES‐buffered saline (HBS; see recipe)
  • 1 M CaCl 2
  • Smooth muscle remodeling medium (see recipe)
  • Liquid nitrogen
  • 2‐Methylbutane bath
  • Masson's Trichrome staining kit (Sigma or Richard Allen Scientific)
  • 0.45‐µm bottle top filters with flasks
  • 10‐cm cell culture dishes (e.g., Nunc)
  • Phase contrast microscope with camera
  • Cryostat (e.g., Richard Allen Scientific)
  • DPX mounting media (Sigma)
  • Silane‐coated microscope slides (Fisher Scientific)
  • Coplin staining jars
  • Square embedding molds, 22 × 22 mm (Tissue‐Tek)
  • Ethanol: 100%, 90%, 70%, and 50%
  • Xylol
  • Etching pen or cork borer
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Asahara, T., Murohara, T., Sullivan, A., Silver, M., van der Zee, R., Li, T., Witzenbichler, B., Schatteman, G., and Isner, J.M. 1997. Isolation of putative progenitor endothelial cells for angiogenesis. Science 275:964‐967.
   Breyer, A., Estharabadi, N., Masayuki, O., Ulloa, F., Nelson‐Holte, M., Lien, L., and Jiang, Y. 2006. Multipotent adult progenitor cell (MAPC) isolation and culture procedures. Exp. Hematol. In press.
   Carmeliet, P. 2005. Angiogenesis in life, disease and medicine. Nature 438:932‐936.
   Fujikawa, T., Oh, S.H., Pi, L., Hatch, H.M., Shupe, T., and Petersen, B.E. 2005. Teratoma formation leads to failure of treatment for type I diabetes using embryonic stem cell‐derived insulin‐producing cells. Am. J. Pathol. 166:1781‐1791.
   Gerecht‐Nir, S., Ziskind, A., Cohen, S., and Itskovitz‐Eldor, J. 2003. Human embryonic stem cells as an in vitro model for human vascular development and the induction of vascular differentiation. Lab. Invest. 83:1811‐1820.
   Hirashima, M., Kataoka, H., Nishikawa, S., Matsuyoshi, N., and Nishikawa, S. 1999. Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood 93:1253‐1263.
   Jiang, Y., Jahagirdar, B.N., Reinhardt, R.L., Schwartz, R.E., Keene, C.D., Ortiz‐Gonzalez, X.R., Reyes, M., Lenvik, T., Lund, T., Blackstad, M., Du, J., Aldrich, S., Lisberg, A., Low, W.C., Largaespada, D.A., and Verfaillie, C.M. 2002. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:41‐49.
   Kitahara, T., Hiromura, K., Ikeuchi, H., Yamashita, S., Kobayashi, S., Kuroiwa, T., Kaneko, Y., Ueki, K., and Nojima, Y. 2005. Mesangial cells stimulate differentiation of endothelial cells to form capillary‐like networks in a three‐dimensional culture system. Nephrol. Dial. Transplant. 20:42‐49.
   Kleinman, H.K., McGarvey, M.L., Hassell, J.R., Star, V.L., Cannon, F.B., Laurie, G.W., and Martin, G.R. 1986. Basement membrane complexes with biological activity. Biochemistry 25:312‐318.
   Kubota, Y., Kleinman, H.K., Martin, G.R., and Lawley, T.J. 1988. Role of laminin and basement membrane in the morphological differentiation of human endothelial cells into capillary‐like structures. J. Cell. Biol. 107:1589‐1598.
   Levenberg, S., Golub, J.S., Amit, M., Itskovitz‐Eldor, J., and Langer, R. 2002. Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 99:4391‐4396.
   Mahoney, W.M. and Schwartz, S.M. 2005. Defining smooth muscle cells and smooth muscle injury. J. Clin. Invest. 115:221‐224.
   Owens, G.K. 1995. Regulation of differentiation of vascular smooth muscle cells. Physiol. Rev. 75:487‐517.
   Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284:143‐147.
   Rehman, J., Li, J., Orschell, C.M., and March, K.L. 2003. Peripheral blood “endothelial progenitor cells” are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation 107:1164‐1169.
   Reyes, M., Lund, T., Lenvik, T., Aguiar, D., Koodie, L., and Verfaillie, C.M. 2001. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 98:2615‐2625.
   Reyes, M., Dudek, A., Jahagirdar, B., Koodie, L., Marker, P.H., and Verfaillie, C.M. 2002. Origin of endothelial progenitors in human postnatal bone marrow. J. Clin. Invest. 109:337‐346.
   Ross, J.J. and Tranquillo, R.T. 2003. ECM gene expression correlates with in vitro tissue growth and development in fibrin gel remodeled by neonatal smooth muscle cells. Matrix Biol. 22:477‐490.
   Schmeisser, A., Garlichs, C.D., Zhang, H., Eskafi, S., Graffy, C., Ludwig, J., Strasser, R.H., and Daniel, W.G. 2001. Monocytes coexpress endothelial and macrophagocytic lineage markers and form cord‐like structures in Matrigel under angiogenic conditions. Cardiovasc. Res. 49:671‐680.
   Sinha, S., Hoofnagle, M.H., Kingston, P.A., McCanna, M.E., and Owens, G.K. 2004. Transforming growth factor‐beta1 signaling contributes to development of smooth muscle cells from embryonic stem cells. Am. J. Physiol. Cell. Physiol. 287:C1560‐C1568.
   Sone, M., Itoh, H., Yamashita, J., Yurugi‐Kobayashi, T., Suzuki, Y., Kondo, Y., Nonoguchi, A., Sawada, N., Yamahara, K., Miyashita, K., Park, K., Shibuya, M., Nito, S., Nishikawa, S., and Nakao, K. 2003. Different differentiation kinetics of vascular progenitor cells in primate and mouse embryonic stem cells. Circulation 107:2085‐2088.
   Taub, M., Wang, Y., Szczesny, T.M., and Kleinman, H.K. 1990. Epidermal growth factor or transforming growth factor alpha is required for kidney tubulogenesis in matrigel cultures in serum‐free medium. Proc. Natl. Acad. Sci. U.S.A. 87:4002‐4006.
   Tsai, R.Y. and McKay, R.D. 2000. Cell contact regulates fate choice by cortical stem cells. J. Neurosci. 20:3725‐3735.
   Vittet, D., Prandini, M.H., Berthier, R., Schweitzer, A., Martin‐Sisteron, H., Uzan, G., and Dejana, E. 1996. Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps. Blood 88:3424‐3431.
   Wiles, M.V. 1993. Embryonic stem cell differentiation in vitro. Methods Enzymol. 225:900‐918.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library