Gene and Genome Construction in Yeast

Daniel G. Gibson1

1 The J. Craig Venter Institute, San Diego, California
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 3.22
DOI:  10.1002/0471142727.mb0322s94
Online Posting Date:  April, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The yeast Saccharomyces cerevisiae has the capacity to take up and assemble dozens of different overlapping DNA molecules in one transformation event. These DNA molecules can be single‐stranded oligonucleotides, to produce gene‐sized fragments, or double‐stranded DNA fragments, to produce molecules up to hundreds of kilobases in length, including complete bacterial genomes. This unit presents protocols for designing the DNA molecules to be assembled, transforming them into yeast, and confirming their assembly. Curr. Protoc. Mol. Biol. 94:3.22.1‐3.22.17. © 2011 by John Wiley & Sons, Inc.

Keywords: DNA assembly; DNA construction; in vivo recombination; yeast recombination; yeast transformation; gene construction; genome construction; synthetic biology

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Strategy for Design and DNA Preparation of Overlapping Single‐Stranded Oligonucleotides and Their Assembly Vectors
  • Basic Protocol 2: Strategy for Design and Preparation of Overlapping Double‐Stranded DNA Fragments and Their Assembly Vectors
  • Basic Protocol 3: Introducing DNA into Yeast for Assembly into Genes and Genomes
  • Basic Protocol 4: Identifying Yeast Clones Containing the Assembled Products
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Strategy for Design and DNA Preparation of Overlapping Single‐Stranded Oligonucleotides and Their Assembly Vectors

  Materials
  • Yeast/E. coli shuttle vector: e.g., pRS313 (ATCC #77142), pRS314 (ATCC #77143), pRS315 (ATCC #77144), or pRS316 (ATCC #77145)
  • Primers for assembly vector amplification (e.g., for pRS313)
    • Forward primer: 5′‐gatcctctagagtcgacctgcaggaattcgatatcaagcttatcg‐3′
    • Reverse primer: 5′‐cgggtaccgagctcgaattcggagctccaattcgccctat‐3′
  • High‐fidelity PCR amplification kit (e.g., Phusion Hot Start polymerase, NEB)
  • 1% low‐melting‐point (LMP) agarose gel
  • Tris/EDTA (TE) buffer, pH 8.0 ( appendix 22)
  • Gel extraction kit (e.g., Qiagen Gel Extraction Kit), optional
  • Thermal cycler
  • DNA analysis software, e.g., Vector NTI (Invitrogen), Clone Manager (Sci‐Ed), or CLC Genomics Workbench (CLCbio)
  • Additional reagents and equipment for performing amplification of DNA by PCR (unit 15.1), agarose gel electrophoresis (unit 2.5), gel extraction of DNA (unit 2.6, optional), and quantitation of DNA with absorption or fluorescence spectroscopy ( appendix 3D)

Basic Protocol 2: Strategy for Design and Preparation of Overlapping Double‐Stranded DNA Fragments and Their Assembly Vectors

  Materials
  • Yeast/E. coli shuttle vector: e.g., pRS313 (ATCC #77142), pRS314 (ATCC #77143), pRS315 (ATCC #77144), and pRS316 (ATCC #77145)
  • Primers for assembly vector amplification (e.g., see Figure )
  • Overlapping DNA molecules of interest to be assembled
  • High‐fidelity PCR amplification kit (e.g., Phusion Hot Start polymerase, NEB)
  • 1% low‐melting‐point (LMP) agarose
  • Gel‐extraction kit, e.g. Qiagen (optional)
  • PCR purification kit (optional: to be used in place of gel extraction procedure)
  • Tris/EDTA (TE) buffer, pH 8.0 ( appendix 22)
  • Thermal cycler
  • DNA analysis software: e.g., Vector NTI (Invitrogen), Clone Manager (Sci‐Ed), or CLC Genomics Workbench (CLCbio)
  • Additional reagents and equipment for performing amplification of DNA by PCR (unit 15.1), agarose gel electrophoresis (unit 2.5), gel extraction of DNA (unit 2.6, optional), and quantitation of DNA with absorption or fluorescence spectroscopy ( appendix 3D)

Basic Protocol 3: Introducing DNA into Yeast for Assembly into Genes and Genomes

  Materials
  • Yeast strain to be transformed (e.g., VL6‐48, ATCC #MYA‐3666), frozen glycerol stock
  • YPAD100 agar plates (see recipe)
  • YPAD100 liquid medium (see recipe)
  • Sterile water
  • 1 M sorbitol
  • Sorbitol/sodium phosphate/EDTA (SPE) solution (see recipe)
  • 14 M 2‐mercaptoethanol (2‐ME)
  • Zymolyase‐20T (ICN Biochemicals, cat. no. 320921) solution
  • STC solution (see recipe)
  • 1 M sorbitol/15% (v/v) DMSO solution (optional): prepare fresh from sterilized solutions
  • Selective regeneration bottom plates (see recipe)
  • Selective regeneration top agar (see recipe)
  • Dry ice/ethanol bath
  • Transforming DNA (e.g., from Basic Protocol protocol 11 or protocol 22)
  • PEG 8000/CaCl 2 solution (see recipe)
  • SOS solution (see recipe)
  • 30°C incubator, with and without rotating platform
  • 250‐ml cell culture flasks
  • 50‐ml screw‐cap centrifuge tubes
  • 1‐, 5‐, and 25‐ml pipets
  • Ice bucket with cover
  • 30°C and 55°C water baths
  • 1.5‐ml microcentrifuge tubes
  • −80°C freezer
  • 1‐ml wide‐bore micropipettor tips
  • 15‐ml conical centrifuge tubes (e.g., BD Falcone)

Basic Protocol 4: Identifying Yeast Clones Containing the Assembled Products

  Materials
  • Yeast clones containing assembled DNA (from protocol 3)
  • Complete minimal (CM) dropout plates (unit 13.1)
  • Complete minimal (CM) selective liquid medium (unit 13.1)
  • Sterile water
  • Cell resuspension buffer: Buffer P1 (Qiagen) or see recipe
  • 14 M 2‐mercaptoethanol (2‐ME)
  • Zymolyase‐100T solution (see recipe)
  • Alkaline‐lysis buffer: Buffer P2 (Qiagen) or see recipe
  • Neutralization buffer: Buffer P3 (Qiagen) or see recipe
  • Miniprep DNA purification kit (Qiagen), optional
  • Isopropanol
  • 70% ethanol
  • Tris/EDTA (TE) buffer, pH 8.0 ( appendix 22)
  • PCR kit for screening yeast clones (e.g., Phusion Hot Start polymerase, NEB) or multiplex PCR screening kit (e.g., Qiagen)
  • Diagnostic primers to confirm the assembled product: e.g., M13F and M13R or appropriate primers spanning assembled junctions (for multiplex PCR)
  • 1% agarose gel (unit 2.5)
  • Electrocompetent E. coli cells (e.g., Epicentre, EPI300)
  • LB medium (unit 1.1) + appropriate antibiotic (e.g., 100 µg/ml carbenicillin)
  • LB plates (unit 1.1) + appropriate antibiotic
  • DNA miniprep kit (e.g., Qiagen)
  • 10‐µl and 1‐ml pipet tips
  • 30°C air incubator
  • 1.5‐ml microcentrifuge tubes
  • 1‐mm electrocuvettes (BioRad)
  • Electroporation system (Gene Pulser Xcell System, BioRad)
  • Additional reagents and equipment for purifying DNA (unit 2.1), isolating plasmid DNA (unit 1.6), and performing agarose gel electrophoresis (unit 2.5)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bell, S.P. 1995 Eukaryotic replicators and associated protein complexes. Curr. Opin. Genet. Dev. 5:162‐167.
   Burgers, P.M. and Percival, K.J. 1987. Transformation of yeast spheroplasts without cell fusion. Anal. Biochem. 163:391‐397.
   Ebersole, T., Okamoto, Y., Noskov, V.N., Kouprina, N., Kim, J.H., Leem, S.H., Barrett, J.C., Masumoto, H., and Larionov, V. 2005. Rapid generation of long synthetic tandem repeats and its application for analysis in human artificial chromosome formation. Nucleic Acids Res. 33:e130.
   Gibson, D.G. 2009. Synthesis of DNA fragments in yeast by one‐step assembly of overlapping oligonucleotides. Nucleic Acids Res. 37:6984‐6990.
   Gibson, D.G., Benders, G.A., Andrews‐Pfannkoch, C., Denisova, E.A., Baden‐Tillson, H., Zaveri, J., Stockwell, T.B., Brownley, A., Thomas, D.W., Algire, M.A., Merryman, C., Young, L., Noskov, V.N., Glass, J.I., Venter, J.C., Hutchison, C.A., 3rd, and Smith, H.O. 2008a. Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science 319:1215‐1220.
   Gibson, D.G., Benders, G.A., Axelrod, K.C., Zaveri, J., Algire, M.A., Moodie, M., Montague, M.G., Venter, J.C., Smith, H.O., and Hutchison, C.A. 3rd. 2008b. One‐step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome. Proc. Natl. Acad. Sci. U.S.A. 105:20404‐20409.
   Gibson, D.G., Glass, J.I., Lartigue, C., Noskov, V.N., Chuang, R.Y., Algire, M.A., Benders, G.A., Montague, M.G., Ma, L., Moodie, M.M., Merryman, C., Vashee, S., Krishnakumar, R., Assad‐Garcia, N., Andrews‐Pfannkoch, C., Denisova, E.A., Young, L., Qi, Z.Q., Segall‐Shapiro, T.H., Calvey, C.H., Parmar, P.P., Hutchison, C.A. 3rd, Smith, H.O., and Venter, J.C., 2010. Creation of a bacterial cell controlled by a chemically synthesized genome. Science 329:52‐56.
   Hinnen, A., Hicks, J.B., and Fink, G.R. 1978. Transformation of yeast. Proc. Natl. Acad. Sci. U.S.A. 75:1929‐1933.
   Kornberg, R.D. 1999. Eukaryotic transcriptional control. Trends Cell Biol. 9:M46‐M49.
   Kouprina, N. and Larionov, V. 2008. Selective isolation of genomic loci from complex genomes by transformation‐associated recombination cloning in the yeast Saccharomyces cerevisiae. Nat. Protoc. 3:371‐377.
   Kozak, M. 1999. Initiation of translation in prokaryotes and eukaryotes. Gene 234:187‐208.
   Larionov, V., Kouprina, N., Eldarov, M., Perkins, E., Porter, G., and Resnick, M.A. 1994. Transformation‐associated recombination between diverged and homologous DNA repeats is induced by strand breaks. Yeast 10:93‐104.
   Larionov, V., Kouprina, N., Graves J., Chen, X.N., Korenberg, J.R., and Resnick, M.A. 1996. Specific cloning of human DNA as yeast artificial chromosomes by transformation‐associated recombination. Proc. Natl. Acad. Sci. U.S.A. 93:491‐496.
   Leem, S.H., Noskov, V.N., Park, J.E., Kim, S.I., Larionov, V., and Kouprina, N. 2003. Optimum conditions for selective isolation of genes from complex genomes by transformation‐associated recombination cloning. Nucleic Acids Res. 31:e29.
   Ma, H., Kunes, S., Schatz, P.J., and Botstein, D. 1987. Plasmid construction by homologous recombination in yeast. Gene 58:201‐216.
   Marschall, P., Malik, N., and Larin, Z. 1999. Transfer of YACs up to 2.3 Mb intact into human cells with polyethylenimine. Gene Ther. 6:1634‐1637.
   Marykwas, D.L. and Passmore, S.E. 1995. Mapping by multifragment cloning in vivo. Proc. Natl. Acad. Sci. U.S.A. 92:11701‐11705.
   Orr‐Weaver, T.L., Szostak, J.W., and Rothstein, R.J. 1981. Yeast transformation: A model system for the study of recombination. Proc. Natl. Acad. Sci. U.S.A. 78:6354‐6358.
   Raymond, C.K., Pownder, T.A., and Sexson, S.L. 1999. General method for plasmid construction using homologous recombination. Biotechniques 26:134‐141.
   Raymond, C.K., Sims, E.H., and Olson, M.V. 2002. Linker‐mediated recombinational subcloning of large DNA fragments using yeast. Genome Res. 12:190‐197.
   Reese, C.B. 2005. Oligo‐ and poly‐nucleotides: 50 years of chemical synthesis. Org. Biomol. Chem. 3:3851‐3868.
   Stemmer, W.P., Crameri, A., Ha, K.D., Brennan, T.M., and Heyneker, H.L. 1995. Single‐step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene 164:49‐53.
   Thompson, J.D., Higgins, D.G., and Gibson, T.J. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673‐4680.
   van Brabant, A.J., Buchanan, C.D., Charboneau, E., Fangman, W.L., and Brewer, B.J. 2001. An origin‐deficient yeast artificial chromosome triggers a cell cycle checkpoint. Mol. Cell 7:705‐713.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library