Construction of Normalized RNA‐seq Libraries for Next‐Generation Sequencing Using the Crab Duplex‐Specific Nuclease

Danos C. Christodoulou1, Joshua M. Gorham1, Daniel S. Herman1, J.G. Seidman1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.12
DOI:  10.1002/0471142727.mb0412s94
Online Posting Date:  April, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

RNA‐seq is a method for studying the transcriptome of cells or tissues by massively parallel sequencing of tens of millions of short DNA fragments. However, the broad dynamic range of gene expression levels, which span more than five orders of magnitude, necessitates considerable over‐sequencing to characterize low‐abundance RNAs at sufficient depth. Here, we describe a method that enables efficient sequencing of low‐abundance RNAs by normalizing or reducing the range spanned by the most abundant RNA species to the least abundant RNA species. This normalization is achieved using an approach that was developed for generating expressed sequence tag (EST) libraries that uses the crab duplex‐specific nuclease and exploits the kinetics of DNA annealing. That is, double‐stranded cDNA is denatured, then allowed to partially re‐anneal, and the most abundant species, which re‐anneal most rapidly, are digested with crab duplex‐specific nuclease. This procedure substantially decreases the proportion of sequence reads from highly expressed RNAs, facilitating assessment of the full spectrum of the sequence and structure of transcriptomes. Curr. Protoc. Mol. Biol. 94:4.12.1‐4.12.11. © 2011 by John Wiley & Sons, Inc.

Keywords: RNA‐seq; library normalization; crab duplex nuclease; high‐throughput DNA sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Dynabeads mRNA DIRECT kit (Invitrogen, cat. no. 610‐12) containing:
    • Lysis/binding buffer
    • Washing buffer B
  • DynaMag‐2 magnet (Invitrogen, cat. no. 123‐21D)
  • RNA, purified using TRIzol (Invitrogen, cat. no 15596‐018) or RNeasy kit (Qiagen, cat. no. 74104)
  • Quant‐iT RNA assay kit (Invitrogen, cat. no. Q32852)
  • 5× fragmentation buffer (see recipe)
  • 3 M sodium acetate, pH 5.7
  • Glycogen (Roche, cat. no. 10901393001)
  • 70% (v/v) and 100% ethanol
  • SuperScript III cDNA synthesis kit (Invitrogen, cat. no. 18080‐051) containing:
    • 10 mM dNTPs
    • 0.1 M DTT
    • 10× RT buffer
    • RNase OUT
    • SuperScript III reverse transcriptase
    • Random hexamers
    • 25 mM MgCl 2
    • E. coli RNase H
  • Second‐strand buffer (Invitrogen, cat, no. 10812‐014)
  • E. coli DNA polymerase I (Invitrogen, cat. no. 18010025)
  • QIAquick PCR purification kit (Qiagen, cat. no. 28104) containing:
    • Buffer EB
  • End‐It DNA End‐Repair kit (Epicentre Biotechnologies, cat. no. ER81050) containing:
    • 10× End‐repair buffer
    • ATP
    • dNTPs
    • End‐repair enzyme mix
  • dATP (Roche, cat. no. 11051440001)
  • NEB2 buffer (New England Biolabs)
  • 3′‐5′ KlenowExo (New England Biolabs, cat. no. M0212s)
  • Quick Ligation kit (New England BioLabs, cat. no. M2200L) containing:
    • 2× ligation buffer
    • Quick T4 DNA ligase
  • MinElute PCR purification kit (Qiagen, cat. no. 28004)
  • 50‐bp ladder (New England Biolabs, cat. no. N3236L)
  • 25‐bp ladder (Invitrogen, cat. no. 10597‐011)
  • SYBR Gold (Invitrogen, cat. no. S‐11494)
  • QIAquick Gel Extraction Kit (Qiagen, cat. no. 28004)
  • Phusion High‐Fidelity DNA Polymerase (New England Biolabs, cat. no. F‐530S) containing 5× HF Phusion buffer
  • Oligonucleotides (see Table 4.12.1)
  • SYBR Green I (Invitrogen, cat. no. S7563)
  • AMPure beads (Agencourt AMPure kit, cat. no. A29152)
  • Quant‐iT dsDNA HS Assay kit (Invitrogen, cat. no. Q32851)
  • 4% to 20% TBE gel (Invitrogen, cat. no. EC62252BOX)
  • 4× hybridization buffer (see recipe)
  • Duplex‐specific nuclease (Evrogen, cat. no. EVN‐EA001‐KI01) containing:
    • 10× master buffer
    • DSN enzyme
  • EDTA
  • UV transilluminator
  • Vortex
  • 1.5‐ml nonstick RNase‐free microcentrifuge tubes (Ambion, cat. no. 12450)
  • Heat block or incubator at 61° to 73°C
  • Qubit fluorometer (Invitrogen, cat. no. Q32857)
  • Dark Reader Transilluminator (Clarechemical, cat. no. DR‐88M)
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
    Table 4.2.1   MaterialsOligonucleotide Sequences

    Oligonucleotide Sequence
    PE adapter 1 a 5′ phosphate‐GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
    PE adapter 2 a 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    Inner PE primer 1 5′ CACGACGCTCTTCCGATCT
    Inner PE primer 2 5′ CTGAACCGCTCTTCCGATCT
    Final PE primer 1 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    Final PE primer 2 5′CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

     aTo prepare the adapter, resuspend each adapter oligonucleotide to 200 µM using water or reduced Tris‐EDTA buffer. Mix equal amounts of each adapter oligonucleotide. Using a thermal cycler, anneal using the program: 4 min at 95°C, −0.1°C/sec to 12°C, hold at 4°C. The annealed adapters can be stored at −20°C until use.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Cloonan, N., Forrest, A.R., Kolle, G., Gardiner, B.B., Faulkner, G.J., Brown, M.K., Taylor, D.F., Steptoe, A.L., Wani, S., Bethel, G., Robertson, A.J., Perkins, A.C., Bruce, S.J., Lee, C.C., Ranade, S.S., Peckham, H.E., Manning, J.M., McKernan, K.J., and Grimmond, S.M. 2008. Stem cell transcriptome profiling via massive‐scale mRNA sequencing. Nat. Methods 5:613‐619.
   Kim, J.B., Porreca, G.J., Song, L., Greenway, S.C., Gorham, J.M., Church, G.M., Seidman, C.E., and Seidman, J.G. 2007. Polony multiplex analysis of gene expression (PMAGE) in mouse hypertrophic cardiomyopathy. Science 316:1481‐1484.
   Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. 2008. Mapping and quantifying mammalian transcriptomes by RNA‐Seq. Nat. Methods 5:621‐628.
   Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., and Snyder, M. 2008. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320:1344‐1349.
   Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., and Ragg, T. 2006. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 7:3.
   Sultan, M., Schulz, M.H., Richard, H., Magen, A., Klingenhoff, A., Scherf, M., Seifert, M., Borodina, T., Soldatov, A., Parkhomchuk, D., Schmidt, D., O'Keeffe, S., Haas, S., Vingron, M., Lehrach, H., and Yaspo, M.L. 2008. A global view of gene activity and alternative splicing by deep sequencing of the human transcriptome. Science 321:956‐960.
   Tang, F., Barbacioru, C., Wang, Y., Nordman, E., Lee, C., Xu, N., Wang, X., Bodeau, J., Tuch, B.B., Siddiqui, A., Lao, K., and Surani, M.A. 2009. mRNA‐Seq whole‐transcriptome analysis of a single cell. Nat. Methods 6:377‐382.
   Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. 2010. Transcript assembly and quantification by RNA‐Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28:511‐515.
   Wang, E.T. 2008. Alternative isoform regulation in human tissue transcriptomes. Nature 456:470‐476.
   Zhulidov, P.A., Bogdanova, E.A., Shcheglov, A.S., Vagner, L.L., Khaspekov, G.L., Kozhemyako, V.B., Matz, M.V., Meleshkevitch, E., Moroz, L.L., Lukyanov, S.A., and Shagin, D.A. 2004. Simple cDNA normalization using kamchatka crab duplex‐specific nuclease. Nucleic Acids Res. 32:e37.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library