Native Elongating Transcript Sequencing (NET‐seq)

L. Stirling Churchman1, Jonathan S. Weissman2

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, 2 Department of Cellular and Molecular Pharmacology, Howard Hughes Medical Institute, University of California San Francisco and California Institute for Quantitative Biosciences, San Francisco, California
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.14
DOI:  10.1002/0471142727.mb0414s98
Online Posting Date:  April, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Advances in sequencing technology have led to the development of many high‐resolution methodologies that observe genomic activity and gene expression. This unit describes such an approach, native elongating transcript sequencing (NET‐seq), which reveals the density of RNA polymerase across the Saccharomyces cerevisiae genome with single‐nucleotide resolution. A procedure for capturing nascent RNA transcripts directly from live cells through their association with the DNA‐RNA‐RNAP ternary complex is described. A protocol to create DNA libraries from the nascent RNA, allowing the identity and abundance of the 3′ end of purified transcripts to be revealed by next generation sequencing, is also provided. By deep sequencing this DNA library, a quantitative measure of RNAP density with single‐nucleotide precision is obtained. The quantitative nature of the NET‐seq dataset relies on the high efficiency of many steps in the protocol. The steps that are most critical are described with suggestions for monitoring their success. Curr. Protoc. Mol. Biol. 98:14.4.1‐14.4.17. © 2012 by John Wiley & Sons, Inc.

Keywords: nascent transcript purification; transcription; DNA library generation strategies

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Purification of Nascent RNA by Immunoprecipitation of RNA Polymerase
  • Basic Protocol 2: Constructing a DNA Sequencing Library from the 3′ Ends of Nascent RNA
  • Support Protocol 1: Yeast Cell Harvesting by Filtration and Cryogenic Lysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Purification of Nascent RNA by Immunoprecipitation of RNA Polymerase

  Materials
  • Agarose slurry conjugated with FLAG antibody (Sigma)
  • Lysis buffer (see recipe), ice cold
  • Yeast grindate (see protocol 3)
  • 1 U/µl DNase I (RQ1 RNase‐free DNase, Promega)
  • 2× SDS buffer (see recipe)
  • Wash buffer (see recipe)
  • 2 mg/ml 3× FLAG peptide (Sigma)
  • Qiagen miRNeasy mini kit
  • Membrane
  • FLAG antibody
  • 15‐ml conical tubes
  • Refrigerated centrifuge
  • Nutator, 4°C
  • 1.5‐ml microcentrifuge tubes

Basic Protocol 2: Constructing a DNA Sequencing Library from the 3′ Ends of Nascent RNA

  Materials
  • 1 to 3 µg purified RNA (see protocol 1)
  • 10 mM Tris⋅Cl, pH 7.0 and 8.0 (RNase‐free; appendix 22)
  • Oligonucleotides (see Table 4.14.1)
  • Ligation reaction mix (see recipe)
  • 200,000 U/ml truncated T4 RNA ligase 2 (NEB)
  • 0.5 M EDTA (RNase‐free; appendix 22)
  • 2× alkaline fragmentation buffer (see recipe)
  • RNA precipitation solution (see recipe)
  • Isopropanol
  • 80% ethanol, ice cold
  • 2× TBU denaturing loading buffer (Invitrogen)
  • 10‐bp DNA ladder
  • DEPC‐treated water
  • 15% TBE‐urea polyacrylamide gel (Invitrogen)
  • SYBR gold (Invitrogen)
  • 1× TBE (Ambion)
  • Costar Spin‐X centrifuge tube filter (0.45‐µm cellulose acetate in 2‐ml tube; Corning)
  • 15 mg/ml GlycoBlue (Ambion)
  • 3 M sodium acetate, pH 5.5 (RNase‐free; appendix 22)
  • RT reaction mix (see recipe)
  • Superaise.In/DTT mix (see recipe)
  • 200 U/µl Superscript III (Invitrogen)
  • 1 M NaOH ( appendix 22)
  • 1 M HCl ( appendix 22)
  • 10% TBE‐urea polyacrylamide gel (Invitrogen)
  • 3 M NaCl ( appendix 22)
  • Circularization mix (see recipe)
  • 100 U/µl CircLigase (Epicentre)
  • PCR master mix (see recipe)
  • 2000 U/µl Phusion DNA polymerase (NEB)
  • 6× DNA loading dye (see recipe)
  • 8% TBE polyacrylamide gel (Invitrogen)
  • DNA soaking buffer (see recipe)
  • 0.5‐ and 1.5‐ml RNase‐free, non‐stick tubes (Ambion)
  • 37°, 48°, 60°, 70°, 80°, 95°, and 98°C heating blocks
  • Refrigerated centrifuge
  • Gel electrophoresis apparatus
  • 20‐G needles
  • Vortex
  • 0.2‐ml thin‐walled PCR tubes
  • Thermal cycler
  • Bioanalyzer DNA high sensitivity chip and reagents (Agilent)
    Table 4.4.1   MaterialsDNA and RNA Oligonucleotide Sequences

    DNA oligonucleotides
    Linker‐1 a 5′ AppCTGTAGGCACCATCAAT/3ddC 3′
    oLSC003 5′Phos/TCGTATGCCGTCTTCTGCTTG/iSp18/CACTCA/iSp18/AATGATACGGCGACCACCGA TCCGACGATCATTGATGGTGCCTACAG 3′ b
    oNTI230 5′ AATGATACGGCGACCACCGA 3′
    oNTI231 5′ CAAGCAGAAGACGGCATACGA 3′
    oMHL001 c 5′AATGATACGGCGACCACCGAGATCGGAAGAGC ACACGTCTGAACTCCAGTCACTGCATC TCCGACGATCATTGATGG 3′
    oMHL002 c 5′ AATGATACGGCGACCACCGAGATCGGAA GAGCACACGTCTGAACTCCAGTCACATGCCA TCCGACGATCATTGATGG 3′
    oLSC006 5′‐TCCGACGATCATTGATGGTGCCTACAG 3′
    RNA oligonucleotide
    oGAB11 5′agu cac uua gcg aug uac acu gac ugu g3′

     aAvailable commercially from Integrated DNA Technologies and NEB.
     biSp18 are 18‐carbon spacers.
     cNote that oMHL001 and oMHL002 are used when barcoding on the Illumina platform is desired. The underlined sequence is the barcode that is read during sequencing. If more than two samples need barcodes, other sequences can be inserted in place of the underlined sequences. Barcodes should be GC balanced and resistant to single base indel conversion.

Support Protocol 1: Yeast Cell Harvesting by Filtration and Cryogenic Lysis

  Materials
  • Liquid nitrogen
  • Yeast strain expressing a C‐terminal epitope tagged (3× FLAG) Rpb3 grown to mid‐log phase in rich YPD medium
  • Microfiltration assembly (90‐mm, ULTRA‐WARE):
    • 4‐liter side‐arm flask with a fritted glass support base
    • Glass funnel
    • Anodized aluminum clamp
    • No. 8 silicone stopper
  • Nitrocellulose (0.45‐µm, 90‐mm diameter membranes; Whatman)
  • Vacuum source
  • Deep Styrofoam container (dry‐ice shipping container) containing tube rack
  • Forceps
  • 50‐ml conical tubes
  • 20‐G needles
  • Metal spatulas with one flat end and one curved end, pre‐chilled
  • Tongs
  • Mixer mill, 50‐ml chambers and 25‐mm stainless steel ball (Retsch) or TissueLyserII (Qiagen)
  • Cryo‐gloves
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 4.14.1 Schematic of the purification of nascent RNA by immunoprecipitation. (A) A yeast culture is grown to mid‐log phase in rich medium. (B) Lysed yeast with DNase I–digested DNA is used for immunoprecipitation of RNAP (C). Nascent RNA is extracted from the purified RNAP (D).
  •   FigureFigure 4.14.2 Schematic of the DNA library construction from nascent RNA. (A) A DNA linker is ligated onto the library of nascent RNA. The ligated product is fragmented using alkaline hydrolysis and size selected to be between 35‐ and 85‐nt long. (B) Reverse transcription converts the RNA into DNA. (C) Circularization of the RT product is performed by CircLigase (Epicentre). (D) The circularized product is used for PCR.
  •   FigureFigure 4.14.3 Representative results of reverse transcription reactions. Lane 1 shows the RT primer. Lane 2 shows a denatured 10‐bp DNA ladder. Lanes 3 to 8 show the reverse transcription product and remaining RT primer from three different nascent transcript samples. The dashed boxes show the product to be excised. Lanes 9 and 10 show the reverse transcription product and remaining RT primer from the oGAB11 control RNA oligo sample. The dashed boxes show the product.
  •   FigureFigure 4.14.4 Images of the filtration and recovery of yeast culture. (A) One liter of yeast culture at mid‐log phase is filtered onto a 0.45‐µm nitrocellulose membrane. (B) The paste of yeast is scraped off using a spatula that has been pre‐chilled in liquid nitrogen.

Videos

Literature Cited

Literature Cited
   Churchman, L.S. and Weissman, J.S. 2011. Nascent transcript sequencing visualizes transcription at nucleotide resolution. Nature 469:368‐373.
   Core, L.J., Waterfall, J.J., and Lis, J.T. 2008. Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322:1845‐1848.
   Mayer, A., Lidschreiber, M., Siebert, M., Leike, K., Söding, J., and Cramer, P. 2010. Uniform transitions of the general RNA polymerase II transcription complex. Nat. Struct. Mol. Biol. 17:1272‐1278.
   Negritto, M.C. and Manthey, G.M. 2008. Overview of Blotting. Curr. Protoc. Essential Lab. Tech. 8.1.1‐8.1.19.
   Unrau, P.J. and Bartel, D.P. 1998. RNA‐catalysed nucleotide synthesis. Nature 395:260‐263.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library