Quantification of microRNA Expression with Next‐Generation Sequencing

Seda Eminaga1, Danos C. Christodoulou1, Francois Vigneault1, George M. Church2, J.G. Seidman3

1 These authors contributed equally to this work, 2 Wyss Institute for Biologically Inspired Engineering, Boston, Massachusetts, 3 Department of Genetics, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.17
DOI:  10.1002/0471142727.mb0417s103
Online Posting Date:  July, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Rapid advancement of next‐generation sequencing technologies has made it possible to study expression profiles of microRNAs (miRNAs) comprehensively and efficiently. Multiplexing miRNA libraries by barcoding can significantly reduce sequencing cost per sample without compromising library quality. This unit provides a step‐by‐step protocol for isolating miRNAs and constructing multiplexed miRNA libraries. Also described is a custom computational pipeline for analyzing the multiplexed miRNA library sequencing reads generated by Illumina‐based technology. Curr. Protoc. Mol. Biol. 103:4.17.1–4.17.14. © 2013 by John Wiley & Sons, Inc.

Keywords: miRNA; sequencing; multiplex; barcode; bioinformatics analysis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation of Total RNA Containing miRNAs
  • Basic Protocol 2: Construction of a Multiplex miRNA Library for Illumina Sequencing
  • Basic Protocol 3: Bioinformatic Analysis of Multiplexed miRNA Library Sequencing Data
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of Total RNA Containing miRNAs

  Materials
  • Tissue of interest, fresh or stored in RNAlater (Qiagen, cat. no. 76106)
  • Trizol (Life Technologies, cat. no. 15596‐026)
  • miRVana miRNA isolation kit (Ambion, cat. no. AM1560)
  • Bioanalyzer 2100 (Agilent) with nano or pico chip
NOTE: To prevent RNase contamination, clean all equipment and the benchtop with RNase Zap (Ambion, cat. no AM9780) before starting the isolation. Use only RNase‐free tubes and micropipet tips, and change gloves frequently.

Basic Protocol 2: Construction of a Multiplex miRNA Library for Illumina Sequencing

  Materials
  • Starting RNA (see protocol 1; RIN ≥8)
  • Nuclease‐free water (Ambion, AM9937)
  • 200 U/µl T4 RNA Ligase 2 Truncated (2tr) and 10× buffer (Enzymatics, L6070L)
  • 10 µM 3′ rApp‐adapter (Table 4.17.1)
  • Dimethyl sulfoxide (DMSO; Sigma, D9170)
  • 40 U/µl RNase inhibitor (Enzymatics, Y9240L)
  • 10 µM RT primer (see Table 4.17.1)
  • 10 µM 5′ RNA adapter (see Table 4.17.1)
  • 10 mM ATP (Enzymatics, N207‐10‐L)
  • 20 U/µl T4 RNA Ligase 1 (Enzymatics, L605L)
  • Superscript III First‐Strand Synthesis System (Invitrogen, 18080‐051), including 5× first‐strand buffer, 100 mM DTT, and 200 U/µl Superscript III
  • 12.5 and 25 mM dNTPs (Enzymatics, N2050L)
  • 2 U/µl Phusion High‐Fidelity DNA Polymerase with 5× buffer (NEB, M0530S)
  • PCR primers: 25 µM BCmiRNA_PCR1 and BCmiRNA_PCR2_BC* (Table 4.17.1)
  • Agencourt AMPure XP 5‐ml Kit (Beckman Coulter Genomics, A63880)
  • 70% (v/v) ethanol
  • 25‐ and 100‐bp RNA ladders (Invitrogen, 10597‐011 and 15628‐019)
  • E‐Gel EX Gel, 2% (Invitrogen, G4020‐02)
  • MinElute Reaction Cleanup Kit (Qiagen, 28204)
  • Agilent High‐Sensitivity DNA Kit (Agilent, 5067‐4626)
  • 200‐µl PCR tubes
  • Thermal cycler (for all incubations)
  • 1.5‐ml microcentrifuge tubes
  • Dynamag‐2 Magnet (Invitrogen, 123‐21D)
  • E‐Gel I‐Base Power System (Invitrogen, G6400)
  • E‐Gel Safe Imager Real‐Time Transilluminator (Invitrogen, G6500)
  • Razor blade
  • Agilent 2100 Bioanalyzer
    Table 4.7.1   Materials   Oligos for Multiplexed miRNA Library Preparation for Illumina Sequencing a   Oligos for Multiplexed miRNA Library Preparation for Illumina Sequencing

    Oligo name b Sequence (5′‐3′) c
    BCPCR_3′rApp‐adapter /5rApp/ACGGGCTAATATTTATCGGTGG/3SpC3/
    BCPCR_5′RNA‐adapter rUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrUrC
    BCPCR_RT primer GCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    BCPCR_PCR2‐BC1 CAAGCAGAAGACGGCATACGAGATCGTGATGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC2 CAAGCAGAAGACGGCATACGAGATACATCGGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC3 CAAGCAGAAGACGGCATACGAGATGCCTAAGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC4 CAAGCAGAAGACGGCATACGAGATTGGTCAGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC5 CAAGCAGAAGACGGCATACGAGATCACTGTGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC6 CAAGCAGAAGACGGCATACGAGATATTGGCGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC7 CAAGCAGAAGACGGCATACGAGATGATCTGGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC8 CAAGCAGAAGACGGCATACGAGATTCAAGTGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC9 CAAGCAGAAGACGGCATACGAGATCTGATCGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC10 CAAGCAGAAGACGGCATACGAGATAAGCTAGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC11 CAAGCAGAAGACGGCATACGAGATGTAGCCGCTCCACCGATAAATATTAGCCCGT
    BCPCR_PCR2‐BC12 CAAGCAGAAGACGGCATACGAGATTACAAGGCTCCACCGATAAATATTAGCCCGT
    BC_Custom_Indexing (optional) ACGGGCTAATATTTATCGGTGGAGC

     aAll oligonucleotides can be ordered through Integrated DNA Technologies (http://www.idtdna.com) and should be ordered with HPLC purification. For a less costly option, the adenylated adapter can be made as described by Vigneault et al. ( ).
     bOligos from Alon et al. ( ).
     cBold, underlined bases represent 6‐nt barcodes.
NOTE: Clean all surfaces and instruments with RNase Zap (Ambion, AM9780) before beginning the protocol, and maintain RNase‐free conditions throughout the protocol.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Alon, S., Vigneault, F., Eminaga, S., Christodoulou, D.C., Seidman, J.G., Church, G.M., and Eisenberg, E. 2011. Barcoding bias in high‐throughput multiplex sequencing of miRNA. Genome Res. 21:1506‐1511.
   Audic, S. and Claverie, J.M. 1997. The significance of digital gene expression profiles. Genome Res. 7:986‐995.
   Cloonan, N., Wani, S., Xu, Q., Gu, J., Lea, K., Heater, S., Barbacioru, C., Steptoe, A.L., Martin, H.C., Nourbakhsh, E., Krishnan, K., Gardiner, B., Wang, X., Nones, K., Steen, J.A., Matigian, N.A., Wood, D.L., Kassahn, K.S., Waddell, N., Shepherd, J., Lee, C., Ichikawa, J., McKernan, K., Bramlett, K., Kuersten, S., and Grimmond, S.M. 2011. MicroRNAs and their isomiRs function cooperatively to target common biological pathways. Genome Biol. 12:R126.
   Hafner, M., Renwick, N., Brown, M., Mihailović, A., Holoch, D., Lin, C., Pena, J.T., Nusbaum, J.D., Morozov, P., Ludwig, J., Ojo, T., Luo, S., Schroth, G., and Tuschl, T. 2011. RNA‐ligase‐dependent biases in miRNA representation in deep‐sequenced small RNA cDNA libraries. RNA 17:1697‐1712.
   Jayaprakash, A.D., Jabado, O., Brown, B.D., and Sachidanandam, R. 2011. Identification and remediation of biases in the activity of RNA ligases in small‐RNA deep sequencing. Nucleic Acids Res. 39:e141.
   Kozomara, A. and Griffiths‐Jones, S. 2011. miRBase: Integrating microRNA annotation and deep‐sequencing data. Nucleic Acids Res. 39:D152‐D157.
   Lee, L.W., Zhang, S., Etheridge, A., Ma, L., Martin, D., Galas, D., and Wang, K. 2010. Complexity of the microRNA repertoire revealed by next‐generation sequencing. RNA 16:2170‐2180.
   Li, Y., Zhang, Z., Liu, F., Vongsangnak, W., Jing, Q., and Shen, B. 2012. Performance comparison and evaluation of software tools for microRNA deep‐sequencing data analysis. Nucleic Acids Res. 40:4298‐4305.
   Mendell, J.T. and Olson, E.N. 2012. MicroRNAs in stress signaling and human disease. Cell 148:1172‐1187.
   Morin, R.D., O'Connor, M.D., Griffith, M., Kuchenbauer, F., Delaney, A., Prabhu, A.L., Zhao, Y., McDonald, H., Zeng, T., Hirst, M., Eaves, C.J., and Marra, M.A. 2008. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Genome Res. 18:610‐621.
   Motameny, S., Wolters, S., Nurnberg, P., and Schumacher, B. 2010. Next generation sequencing of miRNAs—strategies, resources and methods. Genes 1:70‐84.
   Nakashe, P., Obermoeller, D., and Toloue, M.M. 2011. Adapter dimer reduction in high‐throughput microRNA profiling. J. Omics Res. 1:6‐11.
   Pritchard, C.C., Cheng, H.H., and Tewari, M. 2012. MicroRNA profiling: Approaches and considerations. Nat. Rev. Genet. 13:358‐369.
   Vigneault, F., Sismour, A.M., and Church, G.M. 2008. Efficient micoRNA capture and bar‐coding via enzymatic oligonucleotide adenylation. Nat. Methods 5:777‐779.
   Vigneault, F., Ter‐Ovanesyan, D., Alon, S., Eminaga, S., Christodoulou, D., Seidman, J.G., Eisenberg, E., and Church, G. 2012. High‐throughput multiplex sequencing of miRNA. Curr. Protoc. Hum. Genet. 73:11.12.1‐11.12.10.
   Wang, W.C., Lin, F.M., Chang, W.C., Lin, K.Y., Huang, H.D., and Lin, N.S. 2009. miRExpress: Analyzing high‐throughput sequencing data for profiling microRNA expression. BMC Bioinformatics 10:328.
   Wyman, S.K., Knouf, E.C., Parkin, R.K., Fritz, B.R., Lin, D.W., Dennis, L.M., Krouse, M.A., Webster, P.J., and Tewari, M. 2011. Post‐transcriptional generation of miRNA variants by multiple nucleotidyl transferases contributes to miRNA transcriptome complexity. Genome Res. 21:1450‐1461.
   Zhuang, F., Fuchs, R.T., Sun, Z., Zheng, Y., and Robb, G.B. 2012. Structural bias in T4 RNA ligase‐mediated 3′‐adapter ligation. Nucleic Acids Res. 40:e54.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library