Genome‐Wide Annotation and Quantitation of Translation by Ribosome Profiling

Nicholas T. Ingolia1, Gloria A. Brar2, Silvia Rouskin2, Anna M. McGeachy3, Jonathan S. Weissman2

1 Department of Embryology, Carnegie Institution for Science, Baltimore, Maryland, 2 California Institute for Quantitative Biosciences, San Francisco, California, 3 Department of Biology, The Johns Hopkins University, Baltimore, Maryland
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.18
DOI:  10.1002/0471142727.mb0418s103
Online Posting Date:  July, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Protein translation represents a key regulated step in gene expression. Here, we present procedures for comprehensive and quantitative analysis of translation in vivo. This approach, termed ribosome profiling, makes it possible to directly measure the rate of protein synthesis and to reveal the full range of proteins translated by the cell, including unexpected micropeptides and alternative protein isoforms. Ribosome profiling relies on nuclease footprinting of ribosomes onto mRNAs followed by the analysis of these ribosome‐protected fragments by deep sequencing. The protocol presented here encompasses technical optimizations to capture ribosomes at their positions in vivo, perform high‐resolution nuclease footprinting, and prepare deep‐sequencing libraries from these footprints. The alignment of ribosome footprint sequences is discussed as well. The presence of aligned ribosome footprints indicates ribosome occupancy and thus translation, and the density of these footprints reports on the rate of translation. The unit also discusses the use of the translation inhibitor harringtonine to immobilize initiating ribosomes specifically and thereby map sites of translation initiation. Experimental manipulations for ribosome profiling take roughly 5 to 7 days, and sequencing and analysis require an additional 4 to 5 days. © 2013 by John Wiley & Sons, Inc.

Keywords: genomics; translation; next‐generation; sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Ribosome Profiling in Cultured Mammalian Cells
  • Alternate Protocol 1: Pre‐Treatment of Cultured Cells with Elongation Inhibitors
  • Alternate Protocol 2: Pre‐Treatment of Cultured Cells with Initiation Inhibitors
  • Support Protocol 1: Primary Analysis of Ribosome Profiling Data
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Ribosome Profiling in Cultured Mammalian Cells

  Materials
  • Cultures of adherent mammalian cells, e.g., mouse embryonic stem cells (mESCs), HEK293 cells (Ingolia et al., ), HeLa cells, mouse neutrophils (Guo, ), or PC3 cells (Hsieh, ), grown in 10‐cm dishes
  • Phosphate‐buffered saline, pH 7.2 (PBS, appendix 22), ice cold
  • Lysis buffer (see recipe), ice cold
  • 100 U/µl RNase I
  • 20 U/µl SUPERase‐In (Life Technologies)
  • 1 M sucrose cushion (see recipe), ice cold
  • miRNeasy RNA isolation kit (Qiagen)
  • 15 mg/ml GlycoBlue
  • 10 mM Tris⋅Cl, pH 8 ( appendix 22)
  • 10 µM upper‐ and lower‐size marker oligoribonucleotides (Phos indicates 3′ phosphorylation):
    • 5′‐AUGUACACGGAGUCGAGCUCAACCCGCAACGCGA‐(Phos)
    • 5′‐AUGUACACGGAGUCGACCCAACGCGA‐(Phos)
  • 10,000× SYBR Gold (Life Technologies)
  • 1× TBE ( appendix 22)
  • 10× T4 polynucleotide kinase buffer
  • 10 U/µl T4 polynucleotide kinase
  • 0.5 µg/µl preadenylylated 3′ linker (rApp indicates 5′ adenylylation and X indicates a blocked 3′ terminus):
    • 5′‐rAppCTGTAGGCACCATCAAT‐(X)
  • 10× T4 RNA ligase 2 buffer
  • 50% (w/v) PEG 8000
  • 200 U/µl T4 RNA ligase 2, truncated
  • 1.25 µM reverse transcription primer (Phos indicates 5′‐phosphorylation and ‐(SpC18)‐ indicates a hexa‐ethyleneglycol spacer):
    • 5′‐(Phos)‐AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC‐(SpC18)‐CACTCA‐(SpC18)‐TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG.
  • 5× first‐strand buffer
  • 10 mM each dNTP mix ( appendix 22)
  • 0.1 M dithiothreitol ( appendix 22)
  • 200 U/µl M‐MuLV reverse transcriptase, RNase H
  • 1 N NaOH ( appendix 22)
  • 10× CircLigase buffer
  • 1 mM ATP ( appendix 22)
  • 50 mM MnCl 2 ( appendix 22)
  • 100 U/µl CircLigase I (Epicentre)
  • Subtraction oligo mix (see recipe)
  • 20× SSC ( appendix 22)
  • MyOne C1 Streptavidin DynaBeads (Life Technologies)
  • 1× and 2× bind/wash buffer (see recipe)
  • 5× Phusion HF buffer
  • 100 µM forward library PCR primer:
    • 5′‐ AATGATACGGCGACCACCGAGATCTACAC
  • 100 µM indexed reverse library PCR primers (NNNNNN indicates the reverse complement of the index sequence captured during Illumina sequencing):
    • 5′‐CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCG.
  • 2 U/µl Phusion polymerase
  • QuantiFluor dsDNA System (Promega)
  • BioAnalyzer high‐sensitivity DNA kit (Agilent)
  • TruSeq SBS v3 kit, 50 cycles (Illumina)
  • TruSeq SR Cluster kit v3, cBot, HiSeq (Illumina)
  • Aspirator
  • Cell lifter
  • 1.5‐ml non‐stick, RNase‐free microcentrifuge tubes
  • 26‐G needle
  • 1‐ml syringe
  • 13 × 51–mm polycarbonate ultracentrifuge tube
  • Optima TLX ultracentrifuge (Beckman Coulter)
  • TLA 100.3 rotor (Beckman Coulter)
  • Blue‐light transilluminator
  • 37°C, 70°C, and 80°C heating blocks
  • 0.2‐ml PCR tubes
  • Thermal cycler
  • DynaMag‐2 magnetic separation rack (Life Technologies)
  • PCR tube strips
  • Fluorimeter
  • 2100 BioAnalyzer (Agilent)
  • GAII or HiSeq deep sequencer (Illumina)
  • Additional reagents and equipment for purification and concentration of DNA and RNA (unit 2.1; Moore and Dowhan, ), non‐denaturing polyacrylamide gel electrophoresis and subsequent recovery of DNA (unit 2.7; Chory and Pollard, ), and denaturing polyacrylamide gel electrophoresis and subsequent recovery of DNA and RNA (unit 2.12; Ellington and Pollard, )

Alternate Protocol 1: Pre‐Treatment of Cultured Cells with Elongation Inhibitors

  Materials
  • Adherent cultured cells (see Basic Protocol, Materials)
  • 100 mg/ml cycloheximide in DMSO or 100 mg/ml emetine in DMSO

Alternate Protocol 2: Pre‐Treatment of Cultured Cells with Initiation Inhibitors

  Materials
  • Adherent cultured cells (see Basic Protocol, Materials)
  • 2 mg/ml harringtonine in DMSO or 50 mM lactimidomycin in DMSO

Support Protocol 1: Primary Analysis of Ribosome Profiling Data

  Materials
  • 64‐bit computer running Linux with at least 4 GB of RAM
  • FastX‐toolkit (http://hannonlab.cshl.edu/fastx_toolkit/index.html)
  • Bowtie software (http://bowtie‐bio.sourceforge.net/index.shtml)
  • TopHat software (http://tophat.cbcb.umd.edu/)
  • SAMtools software (http://samtools.sourceforge.net/)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Anders, S. and Huber, W. 2010. Differential expression analysis for sequence count data. Genome Biol. 11:R106.
  Aspden, J.L., Eyre‐Walker, Y.C., Phillips, R.J., Amin, U., Mumtaz, M.A., Brocard, M., and Couso, J.P. 2014. Extensive translation of small Open Reading Frames revealed by Poly‐Ribo‐Seq. Elife 3:e03528. doi: 10.7554/eLife.03528.
  Arava, Y., Wang, Y., Storey, J.D., Liu, C.L., Brown, P.O., and Herschlag, D. 2003. Genome‐wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 100:3889‐3894.
  Bazzini, A.A., Lee, M.T., and Giraldez, A.J. 2012. Ribosome profiling shows that miR‐430 reduces translation before causing mRNA decay in zebrafish. Science 336:233‐237.
  Bazzini, A.A., Johnstone, T.G., Christiano, R., Mackowiak, S.D., Obermayer, B., Fleming, E.S., Vejnar, C.E., Lee, M.T., Rajewsky, N., Walther, T.C., et al. 2014. Identification of small ORFs in vertebrates using ribosome footprinting and evolutionary conservation. EMBO J. 33:981‐993.
  Becker, A.H., Oh, E., Weissman, J.S., Kramer, G., and Bukau, B. 2013. Selective ribosome profiling as a tool for studying the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes. Nat. Protoc. 8:2212‐2239.
  Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., Hall, K.P., Evers, D.J., Barnes, C.L., Bignell, H.R., Boutell, J.M., Bryant, J., Carter, R.J., Keira Cheetham, R., Cox, A.J., Ellis, D.J., Flatbush, M.R., Gormley, N.A., Humphray, S.J., Irving, L.J., Karbelashvili, M.S., Kirk, S.M., Li, H., Liu, X., Maisinger, K.S., Murray, L.J., Obradovic, B., Ost, T., Parkinson, M.L., Pratt, M.R., Rasolonjatovo, I.M., Reed, M.T., Rigatti, R., Rodighiero, C., Ross, M.T., Sabot, A., Sankar, S.V., Scally, A., Schroth, G.P., Smith, M.E., Smith, V.P., Spiridou, A., Torrance, P.E., Tzonev, S.S., Vermaas, E.H., Walter, K., Wu, X., Zhang, L., Alam, M.D., Anastasi, C., Aniebo, I.C., Bailey, D.M., Bancarz, I.R., Banerjee, S., Barbour, S.G., Baybayan, P.A., Benoit, V.A., Benson, K.F., Bevis, C., Black, P.J., Boodhun, A., Brennan, J.S., Bridgham, J.A., Brown, R.C., Brown, A.A., Buermann, D.H., Bundu, A.A., Burrows, J.C., Carter, N.P., Castillo, N., Chiara, E.C.M., Chang, S., Neil Cooley, R., Crake, N.R., Dada, O.O., Diakoumakos, K.D., Dominguez‐Fernandez, B., Earnshaw, D.J., Egbujor, U.C., Elmore, D.W., Etchin, S.S., Ewan, M.R., Fedurco, M., Fraser, L.J., Fuentes Fajardo, K.V., Scott Furey, W., George, D., Gietzen, K.J., Goddard, C.P., Golda, G.S., Granieri, P.A., Green, D.E., Gustafson, D.L., Hansen, N.F., Harnish, K., Haudenschild, C.D., Heyer, N.I., Hims, M.M., Ho, J.T., Horgan, A.M., Hoschler, K., Hurwitz, S., Ivanov, D.V., Johnson, M.Q., James, T., Huw Jones, T.A., Kang, G.D., Kerelska, T.H., Kersey, A.D., Khrebtukova, I., Kindwall, A.P., Kingsbury, Z., Kokko‐Gonzales, P.I., Kumar, A., Laurent, M.A., Lawley, C.T., Lee, S.E., Lee, X., Liao, A.K., Loch, J.A., Lok, M., Luo, S., Mammen, R.M., Martin, J.W., McCauley, P.G., McNitt, P., Mehta, P., Moon, K.W., Mullens, J.W., Newington, T., Ning, Z., Ling Ng, B., Novo, S.M., O'Neill, M.J., Osborne, M.A., Osnowski, A., Ostadan, O., Paraschos, L.L., Pickering, L., Pike, A.C., Chris Pinkard, D., Pliskin, D.P., Podhasky, J., Quijano, V.J., Raczy, C., Rae, V.H., Rawlings, S.R., Chiva Rodriguez, A., Roe, P.M., Rogers, J., Rogert Bacigalupo, M.C., Romanov, N., Romieu, A., Roth, R.K., Rourke, N.J., Ruediger, S.T., Rusman, E., Sanches‐Kuiper, R.M., Schenker, M.R., Seoane, J.M., Shaw, R.J., Shiver, M.K., Short, S.W., Sizto, N.L., Sluis, J.P., Smith, M.A., Ernest Sohna Sohna, J., Spence, E.J., Stevens, K., Sutton, N., Szajkowski, L., Tregidgo, C.L., Turcatti, G., Vandevondele, S., Verhovsky, Y., Virk, S.M., Wakelin, S., Walcott, G.C., Wang, J., Worsley, G.J., Yan, J., Yau, L., Zuerlein, M., Mullikin, J.C., Hurles, M.E., McCooke, N.J., West, J.S., Oaks, F.L., Lundberg, P.L., Klenerman, D., Durbin, R., and Smith, A.J. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53‐59.
  Brar, G.A., Yassour, M., Friedman, N., Regev, A., Ingolia, N.T., and Weissman, J.S. 2012. High‐resolution view of the yeast meiotic program revealed by ribosome profiling. Science 335:552‐557.
  Brown, P.O. and Botstein, D. 1999. Exploring the new world of the genome with DNA microarrays. Nat. Genet. 21:33‐37.
  Bullard, J.H., Purdom, E., Hansen, K.D., and Dudoit, S. 2010. Evaluation of statistical methods for normalization and differential expression in mRNA‐Seq experiments. BMC Bioinformatics 11:94.
  Calviello, L., Mukherjee, N., Wyler, E., Zauber, H., Hirsekorn, A., Selbach, M., Landthaler, M., Obermayer, B., and Ohler, U. 2015. Detecting actively translated open reading frames in ribosome profiling data. Nat. Methods. 13:165‐170. doi: 10.1038/nmeth.3688. [Epub ahead of print].
  Chew, G.L., Pauli, A., Rinn, J.L., Regev, A., Schier, A.F., and Valen, E. 2013. Ribosome profiling reveals resemblance between long non‐coding RNAs and 5' leaders of coding RNAs. Development 140:2828‐2834. doi: 10.1242/dev.098343.
  Chory, J. and Pollard, J.D. 1999. Separation of small DNA fragments by conventional gel electrophoresis. Curr. Protoc. Mol. Biol. 47:2.7.1‐2.7.8.
  Crappe, J., Ndah, E., Koch, A., Steyaert, S., Gawron, D., De Keulenaer, S., De Meester, E., De Meyer, T., Van Criekinge, W., Van Damme, P., et al. 2015. PROTEOFORMER: Deep proteome coverage through ribosome profiling and MS integration. Nucleic Acids Res. 43:e29.
  de Boer, E., Rodriguez, P., Bonte, E., Krijgsveld, J., Katsantoni, E., Heck, A., Grosveld, F., and Strouboulis, J. 2003. Efficient biotinylation and single‐step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 100:7480‐7485.
  del Prete, M.J., Vernal, R., Dolznig, H., Mullner, E.W., and Garcia‐Sanz, J.A. 2007. Isolation of polysome‐bound mRNA from solid tissues amenable for RT‐PCR and profiling experiments. RNA 13:414‐421.
  Dinger, M.E., Pang, K.C., Mercer, T.R., and Mattick, J.S. 2008. Differentiating protein‐coding and noncoding RNA: Challenges and ambiguities. PLoS Comput. Biol. 4:e100176.
  Dunn, J.G., Foo, C.K., Belletier, N.G., Gavis, E.R., and Weissman, J.S. 2013. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster. Elife 2:e01179.
  Ellington, A. and Pollard, J. D. 1998. Purification of oligonucleotides using denaturing polyacrylamide gel electrophoresis. Curr. Protoc. Mol. Biol. 42:2.12.1‐2.12.7.
  Fields, A.P., Rodriguez, E.H., Jovanovic, M., Stern‐Ginossar, N., Haas, B.J., Mertins, P., Raychowdhury, R., Hacohen, N., Carr, S.A., Ingolia, N.T., et al. 2015. A regression‐based analysis of ribosome‐profiling data reveals a conserved complexity to mammalian translation. Mol. Cell 60:816‐827.
  Fresno, M., Jimenez, A., and Vazquez, D. 1977. Inhibition of translation in eukaryotic systems by harringtonine. Eur. J. Biochem. 72:323‐330.
  Fritsch, C., Herrmann, A., Nothnagel, M., Szafranski, K., Huse, K., Schumann, F., Schreiber, S., Platzer, M., Krawczak, M., Hampe, J., and Brosch, M. 2012. Genome‐wide search for novel human uORFs and N‐terminal protein extensions using ribosomal footprinting. Genome Res. 22:2208‐2218.
  Garber, M., Grabherr, M.G., Guttman, M., and Trapnell, C. 2011. Computational methods for transcriptome annotation and quantification using RNA‐seq. Nat. Methods 8:469‐477.
  Gerashchenko, M.V. and Gladyshev, V.N. 2014. Translation inhibitors cause abnormalities in ribosome profiling experiments. Nucleic Acids Res. 42:e134.
  Ghaemmaghami, S., Huh, W.K., Bower, K., Howson, R.W., Belle, A., Dephoure, N., O'Shea, E.K., and Weissman, J.S. 2003. Global analysis of protein expression in yeast. Nature 425:737‐741.
  Guo, H., Ingolia, N.T., Weissman, J.S., and Bartel, D.P. 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466:835‐840.
  Guttman, M., Russell, P., Ingolia, N.T., Weissman, J.S., and Lander, E.S. 2013. Ribosome profiling provides evidence that large noncoding RNAs do not encode proteins. Cell 154:240‐251.
  Hafner, M., Renwick, N., Brown, M., Mihailovic, A., Holoch, D., Lin, C., Pena, J.T., Nusbaum, J.D., Morozov, P., Ludwig, J., Ojo, T., Luo, S., Schroth, G., and Tuschl, T. 2011. RNA‐ligase‐dependent biases in miRNA representation in deep‐sequenced small RNA cDNA libraries. RNA 17:1697‐1712.
  Hansen, K.D., Brenner, S.E., and Dudoit, S. 2010. Biases in Illumina transcriptome sequencing caused by random hexamer priming. Nucleic Acids Res. 38:e131.
  Heiman, M., Schaefer, A., Gong, S., Peterson, J.D., Day, M., Ramsey, K.E., Suarez‐Farinas, M., Schwarz, C., Stephan, D.A., Surmeier, D.J., Greengard, P., and Heintz, N. 2008. A translational profiling approach for the molecular characterization of CNS cell types. Cell 135:738‐748.
  Hsieh, A.C., Liu, Y., Edlind, M.P., Ingolia, N.T., Janes, M.R., Sher, A., Shi, E.Y., Stumpf, C.R., Christensen, C., Bonham, M.J., Wang, S., Ren, P., Martin, M., Jessen, K., Feldman, M.E., Weissman, J.S., Shokat, K.M., Rommel, C., and Ruggero, D. 2012. The translational landscape of mTOR signaling steers cancer initiation and metastasis. Nature 22:55‐61.
  Hussmann, J.A., Patchett, S., Johnson, A., Sawyer, S., and Press, W.H. 2015. Understanding biases in ribosome profiling experiments reveals signatures of translation dynamics in yeast. PLoS Genet. 11:e1005732.
  Ingolia, N.T. 2010. Genome‐wide translational profiling by ribosome footprinting. Methods Enzymol. 470:119‐142.
  Ingolia, N.T., Ghaemmaghami, S., Newman, J.R., and Weissman, J.S. 2009. Genome‐wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324:218‐223.
  Ingolia, N.T., Lareau, L.F., and Weissman, J.S. 2011. Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell 147:789‐802.
  Ingolia, N.T., Brar, G.A., Rouskin, S., McGeachy, A.M., and Weissman, J.S. 2012. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome‐protected mRNA fragments. Nat. Protoc. 7:1534‐1550.
  Ingolia, N.T., Brar, G.A., Stern‐Ginossar, N., Harris, M.S., Talhouarne, G.J., Jackson, S.E., Wills, M.R., and Weissman, J.S. 2014. Ribosome profiling reveals pervasive translation outside of annotated protein‐coding genes. Cell Rep. 8:1365‐1379.
  Jan, C.H., Williams, C.C., and Weissman, J.S. 2014. Principles of ER cotranslational translocation revealed by proximity‐specific ribosome profiling. Science 346:1257521.
  Jelenc, P.C. 1980. Rapid purification of highly active ribosomes from Escherichia coli. Anal. Biochem. 105:369‐374.
  Kondo, T., Plaza, S., Zanet, J., Benrabah, E., Valenti, P., Hashimoto, Y., Kobayashi, S., Payre, F., and Kageyama, Y. 2010. Small peptides switch the transcriptional activity of Shavenbaby during Drosophila embryogenesis. Science 329:336‐339.
  Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biol. 10:R25.
  Lareau, L.F., Hite, D.H., Hogan, G.J., and Brown, P.O. 2014. Distinct stages of the translation elongation cycle revealed by sequencing ribosome‐protected mRNA fragments. Elife 3:e01257.
  Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858‐862.
  Lee, S., Liu, B., Huang, S.X., Shen, B., and Qian, S.B. 2012. Global mapping of translation initiation sites in mammalian cells at single‐nucleotide resolution. Proc. Natl. Acad. Sci. U.S.A. 109:E2424‐E2432.
  Levin, J.Z., Yassour, M., Adiconis, X., Nusbaum, C., Thompson, D.A., Friedman, N., Gnirke, A., and Regev, A. 2010. Comprehensive comparative analysis of strand‐specific RNA sequencing methods. Nat. Methods 7:709‐715.
  Li, G.W., Oh, E., and Weissman, J.S. 2012. The anti‐Shine‐Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484:538‐541.
  Li, J., Jiang, H., and Wong, W.H. 2010. Modeling non‐uniformity in short‐read rates in RNA‐Seq data. Genome Biol. 11:R50.
  Linsen, S.E., de Wit, E., Janssens, G., Heater, S., Chapman, L., Parkin, R.K., Fritz, B., Wyman, S.K., de Bruijn, E., Voest, E.E., Kuersten, S., Tewari, M., and Cuppen, E. 2009. Limitations and possibilities of small RNA digital gene expression profiling. Nat. Methods 6:474‐476.
  Lu, P., Vogel, C., Wang, R., Yao, X., and Marcotte, E.M. 2007. Absolute protein expression profiling estimates the relative contributions of transcriptional and translational regulation. Nat. Biotechnol. 25:117‐124.
  Michel, A.M., Choudhury, K.R., Firth, A.E., Ingolia, N.T., Atkins, J.F., and Baranov, P.V. 2012. Observation of dually decoded regions of the human genome using ribosome profiling data. Genome Res. 22:2219‐2229.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
  Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. 2008. Mapping and quantifying mammalian transcriptomes by RNA‐Seq. Nat. Methods 5:621‐628.
  Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., and Snyder, M. 2008. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320:1344‐1349.
  Oh, E., Becker, A.H., Sandikci, A., Huber, D., Chaba, R., Gloge, F., Nichols, R.J., Typas, A., Gross, C.A., Kramer, G., Weissman, J.S., and Bukau, B. 2011. Selective ribosome profiling reveals the cotranslational chaperone action of trigger factor in vivo. Cell 147:1295‐1308.
  Qian, W., Yang, J.‐R., Pearson, N.M., Maclean, C., and Zhang, J. 2012. Balanced codon usage optimizes eukaryotic translational efficiency. PLoS Genet. 8:e1002603.
  Reid, D.W. and Nicchitta, C.V. 2012. Primary role for endoplasmic reticulum‐bound ribosomes in cellular translation identified by ribosome profiling. J. Biol. Chem. 287:5518‐5527.
  Reuter, J.A., Spacek, D.V., and Snyder, M.P. 2015. High‐throughput sequencing technologies. Mol. Cell 58:586‐597.
  Robert, F., Carrier, M., Rawe, S., Chen, S., Lowe, S., and Pelletier, J. 2009. Altering chemosensitivity by modulating translation elongation. PLoS One 4:e5428.
  Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., and Pachter, L. 2011. Improving RNA‐Seq expression estimates by correcting for fragment bias. Genome Biol. 12:R22.
  Sampath, P., Pritchard, D.K., Pabon, L., Reinecke, H., Schwartz, S.M., Morris, D.R., and Murry, C.E. 2008. A hierarchical network controls protein translation during murine embryonic stem cell self‐renewal and differentiation. Cell Stem Cell 2:448‐460.
  Sanz, E., Yang, L., Su, T., Morris, D.R., McKnight, G.S., and Amieux, P.S. 2009. Cell‐type‐specific isolation of ribosome‐associated mRNA from complex tissues. Proc. Natl. Acad. Sci. U.S.A. 106:13939‐13944.
  Schneider‐Poetsch, T., Ju, J., Eyler, D.E., Dang, Y., Bhat, S., Merrick, W.C., Green, R., Shen, B., and Liu, J.O. 2010. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat. Chem. Biol. 6:209‐217.
  Schwanhausser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J., Chen, W., and Selbach, M. 2011. Global quantification of mammalian gene expression control. Nature 473:337‐342.
  Sonenberg, N. and Hinnebusch, A.G. 2009. Regulation of translation initiation in eukaryotes: Mechanisms and biological targets. Cell 136:731‐745.
  Stadler, M. and Fire, A. 2011. Wobble base‐pairing slows in vivo translation elongation in metazoans. RNA 17:2063‐2073.
  Steitz, J.A. 1969. Polypeptide chain initiation: Nucleotide sequences of the three ribosomal binding sites in bacteriophage R17 RNA. Nature 224:957‐964.
  Stern‐Ginossar, N., Weisburd, B., Michalski, A., Le, V.T., Hein, M.Y., Huang, S.X., Ma, M., Shen, B., Qian, S.B., Hengel, H., et al. 2012. Decoding human cytomegalovirus. Science 338:1088‐1093.
  Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. 2010. Transcript assembly and quantification by RNA‐Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28:511‐515.
  Vogel, C. 2011. Translation's coming of age. Mol. Syst. Biol. 7:498.
  Wang, Z., Gerstein, M., and Snyder, M. 2009. RNA‐Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 10:57‐63.
  Williams, C.C., Jan, C.H., and Weissman, J.S. 2014. Targeting and plasticity of mitochondrial proteins revealed by proximity‐specific ribosome profiling. Science 346:748‐751.
  Wolin, S.L. and Walter, P. 1988. Ribosome pausing and stacking during translation of a eukaryotic mRNA. EMBO J. 7:3559‐3569.
  Zhuang, F., Fuchs, R.T., Sun, Z., Zheng, Y., and Robb, G.B. 2012. Structural bias in T4 RNA ligase‐mediated 3′‐adapter ligation. Nucleic Acids Res. 40:e54.
Key References
  Ingolia et al., 2009. See above.
  Describes the ribosome profiling technique and its application in budding yeast.
  Ingolia et al., 2011. See above.
  Describes the application of ribosome profiling and initiation site mapping in mammalian cells.
  Ingolia et al., 2012. See above.
  Original publication of the ribosome profiling protocol presented here.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library