Purification of Radiolabeled RNA Products Using Denaturing Gel Electrophoresis

Hironori Adachi1, Yi‐Tao Yu1

1 Department of Biochemistry and Biophysics, Center for RNA Biology, University of Rochester Medical Center, Rochester, New York
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.20
DOI:  10.1002/0471142727.mb0420s105
Online Posting Date:  January, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit discusses a basic method for purification of radiolabeled RNAs using denaturing polyacrylamide gel electrophoresis. The method consists of a number of experimental procedures, including total RNA preparation from yeast cells, isolation of a specific RNA from total yeast RNA, RNA 3′‐terminal labeling using nucleotide (5′ [32P]pCp) addition (via ligation), denaturing (8 M urea) polyacrylamide gel electrophoresis, and RNA extraction from the gel slice. Key points for achieving good electrophoretic separation of RNA are also discussed. Curr. Protoc. Mol. Biol. 105:4.20.1‐4.20.13. © 2014 by John Wiley & Sons, Inc.

Keywords: RNA purification; radiolabeled RNAs; denaturing polyacrylamide electrophoresis (PAGE); yeast cells; RNA molecular biology

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: RNA Extraction and Purification from Yeast Cells
  • Support Protocol 1: Lysing Cells with a French Press
  • Basic Protocol 2: Radiolabeling tRNA at the 3′ End
  • Basic Protocol 3: Separating and Eluting Radiolabeled RNA Using Denaturing Gel Electrophoresis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: RNA Extraction and Purification from Yeast Cells

  Materials
  • Yeast (BY4741 strain)
  • YPD (see recipe)
  • TRIzol reagent (Invitrogen)
  • Chloroform
  • Isopropyl alcohol
  • 70% ethanol
  • 2.4 M tetraethylammonium chloride (TEACl)
  • Streptavidin beads (Pierce)
  • Binding buffer (see recipe)
  • Biotinylated oligo DNA (5′ biotin‐CGAACGCCCGATCTCAAGATTTACAGTC TTGCGCC‐3′) (Integrated DNA Technologies)
  • Washing buffer (see recipe)
  • 30°C incubator
  • Spectrophotometer
  • Refrigerated centrifuge
  • 0.5‐mm glass beads (BioSpec Products)
  • 1.5‐ and 2‐ml screw‐cap microcentrifuge tubes
  • Mini‐BeadBeater (Biospec Products)
  • 15°C incubator with rotator
  • 60°C heating block
  • Amicon Ultra‐4 10K column (Millipore)

Support Protocol 1: Lysing Cells with a French Press

  Materials
  • Extraction buffer (see recipe), optional
  • 10% SDS
  • Tris·Cl‐saturated 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (PCA)
  • 3 M sodium acetate, pH 5.2, optional
  • Isopropyl alcohol
  • 70% ethanol
  • 2.4 M tetraethylammonium chloride (TEACl)
  • French press (SLM Aminco)
  • Refrigerated centrifuge
  • 50‐ml tubes
  • 65°C water bath
  • Spectrophotometer

Basic Protocol 2: Radiolabeling tRNA at the 3′ End

  Materials
  • tRNA
  • T4 RNA ligase and 10× buffer (Thermo Scientific)
  • 10 mM ATP (Thermo Scientific)
  • 5′ [32P]‐pCp (3000 Ci/mmol, 10 µCi/µl) (Perkin Elmer)
  • G50 buffer (see recipe)
  • Tris·Cl‐saturated 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (PCA)
  • Ethanol
  • 1.5‐ml tubes
  • Vortex
  • Refrigerated centrifuge

Basic Protocol 3: Separating and Eluting Radiolabeled RNA Using Denaturing Gel Electrophoresis

  Materials
  • Sigmacote (Sigma), optional
  • 100% ethanol
  • Urea
  • 5× TBE (see recipe)
  • 40% acrylamide (19:1 acrylamide/bis‐acrylamide)
  • 10% ammonium persulfate (APS)
  • N,N,N′,N′‐ Tetramethylethylenediamine (TEMED)
  • Radiolabeled tRNA
  • 2× RNA sample buffer (see recipe)
  • GeneRuler low range (size markers) (Thermo Scientific)
  • G50 buffer (see recipe)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (PCA)
  • Ethanol
  • 20 × 30–cm glass plates
  • 0.42‐mm thick spacers
  • Gel‐sealing tape
  • Binder clips
  • 42°C water bath
  • 10‐ and 50‐ml syringes
  • Gel comb
  • Plastic wrap
  • Electrophoresis apparatus
  • 95°C heating block
  • Phosphor imaging screens
  • Phosphor imager (e.g., Typhoon or Storm, Molecular Dynamic)
  • Scalpel
  • 1.5‐ml tubes
  • Tube rotator
  • 0.2‐µm filters
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Hutton, J.R. 1977. Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. Nucleic Acids Res. 4:3537‐3555.
  Maniatis, T., Jeffrey, A., and deSande, H.V. 1975. Chain length determination of small double‐ and single‐stranded DNA molecules by polyacrylamide gel electrophoresis. Biochemistry 14:3787‐3794.
  Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual, Chapter 12. Cold Spring Harbor Laboratory Press, New York.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library