Preparation of Single‐Cell RNA‐Seq Libraries for Next Generation Sequencing

John J. Trombetta1, David Gennert1, Diana Lu1, Rahul Satija1, Alex K. Shalek2, Aviv Regev3

1 Broad Institute of MIT and Harvard, Cambridge, Massachusetts, 2 Department of Chemistry and Chemical Biology and Department of Physics, Harvard University, Cambridge, Massachusetts, 3 Howard Hughes Medical Institute, Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.22
DOI:  10.1002/0471142727.mb0422s107
Online Posting Date:  July, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

For the past several decades, due to technical limitations, the field of transcriptomics has focused on population‐level measurements that can mask significant differences between individual cells. With the advent of single‐cell RNA‐Seq, it is now possible to profile the responses of individual cells at unprecedented depth and thereby uncover, transcriptome‐wide, the heterogeneity that exists within these populations. This unit describes a method that merges several important technologies to produce, in high‐throughput, single‐cell RNA‐Seq libraries. Complementary DNA (cDNA) is made from full‐length mRNA transcripts using a reverse transcriptase that has terminal transferase activity. This, when combined with a second “template‐switch” primer, allows for cDNAs to be constructed that have two universal priming sequences. Following preamplification from these common sequences, Nextera XT is used to prepare a pool of 96 uniquely indexed samples ready for Illumina sequencing. Curr. Protoc. Mol. Biol. 107:4.22.1‐4.22.17. © 2014 by John Wiley & Sons, Inc.

Keywords: SMART‐Seq; single‐cell RNA‐Seq; transcriptomics; cell type; single cell; low‐input RNA‐Seq; SMART‐Seq2; Next‐generation sequencing; template‐switching

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: SMART‐Seq Single‐Cell RNA‐Seq (Method)
  • Alternate Protocol 1: SMART‐Seq2 Single‐Cell RNA‐Seq Modified Method
  • Support Protocol 1: Single‐Cell RNA‐Seq Expression Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: SMART‐Seq Single‐Cell RNA‐Seq (Method)

  Materials
  • 2‐Mercaptoethanol, ≥99.0%
  • TCL buffer (Qiagen, cat. no. 1031576)
  • Cell suspension in complete medium
  • Dry ice
  • RNeasy Plus Micro Kit (Qiagen)
  • RNA‐SPRI beads (Agencourt RNAClean XP RNA‐SPRI beads, Beckman Coulter, cat. no. A63987)
  • RNAse decontamination solution (RNaseZap, Life Technologies, cat. no. AM9780)
  • RNase‐free water
  • 80% ethanol
  • SMARTer Ultra‐Low Input RNA Kit for Illumina Sequencing‐HV, 96 reactions (Clontech, cat. no. 634828) containing:
    • Dilution buffer
    • 3′ SMART CDS Primer II A (12 µM): 5′ AAGCAGTGGTATCAACGCAGAGTACT(30)VN
    • RNase inhibitor (40 U/µl)
    • 5× first‐strand buffer (RNase‐free)
    • Dithiothreitol (DTT; 100 mM)
    • SMARTer dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 20 mM)
    • SMARTer II A oligonucleotide (12 µM): 5′ AAGCAGTGGTATCAACGCAGAGTACATrGrGrG
    • SMARTScribe reverse transcriptase (100 U/µl)
    • Nuclease‐free water
    • IS PCR primer (12 µM): 5′ AAGCAGTGGTATCAACGCAGAGT
    • Purification buffer (10 mM Tris·Cl, pH 8.5)
    • Control total RNA (1 µg/µl)
  • Advantage 2 PCR Kit, 100 reactions (Clontech, cat. no. 639206) containing:
    • 10× Advantage 2 PCR buffer
    • 50× dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM)
    • 50× Advantage 2 polymerase mix
    • PCR‐grade water
    • 10× Advantage 2 SA PCR buffer
    • Control DNA template (100 ng/µl)
    • Control primer mix, 5′ primer and 3′ primer (10 µM each)
  • Agencourt AMPure XP SPRI beads (Beckman Coulter, cat. no. A63881)
  • 1 × TE buffer (see recipe)
  • Agilent High Sensitivity DNA Kit (Agilent Technologies, cat. no. 5067‐4626)
  • Qubit dsDNA HS assay kit, 100 reactions (Life Technologies, cat. no. Q32851)
  • Taqman Fast Advanced Master Mix, 100 reactions (Life Technologies, cat. no. 4444557)
  • Taqman Probe set (choose housekeeping genes that are appropriate for specific system)
  • Nextera XT DNA Sample Preparation Kit, 96 samples (Illumina, cat. no. FC‐131‐1096) containing:
    • Amplicon Tagment Mix (ATM)
    • Tagment DNA Buffer (TD)
    • Nextera PCR Master Mix (NPM)
    • Neutralize Tagment Buffer (NT)
    • Resuspension Buffer
    • Library Normalization Additives 1
    • Library Normalization Wash 1
    • Hybridization Buffer
    • Library Normalization Beads 1
    • Library Normalization Storage Buffer 1
  • Nextera XT Index Kit, 96 indices, 384 samples (Illumina, cat. no. FC‐131‐1002) containing:
    • Index primers, S501 to S508 (8 tubes)
    • Index primers, N701 to N712 (12 tubes)
  • 96‐well PCR plates, skirted (Eppendorf, cat. no. 951020401)
  • 1.5‐ml RNAse‐ and DNAse‐free microcentrifuge tubes
  • Microseal F foil (Bio‐Rad, cat. no. MSF‐1001)
  • FACS machine
  • Plate centrifuge
  • Vortex
  • DynaMag‐96 side‐skirted magnet (Life Technologies, cat. no. 12027)
  • 8‐channel pipettor
  • Thermal cycler
  • Microseal B adhesive seals (Bio‐Rad, cat. no. MSB‐1001)
  • 2100 Electrophoresis Bioanalyzer Instrument (Agilent Technologies, cat. no. G2939AA)
  • Qubit assay tubes (Life Technologies, cat. no. Q32856)
  • Qubit 2.0 fluorometer (Life Technologies, cat. no. Q32866)
  • TruSeq Index Plate Fixture Kit (Illumina, cat. no. FC‐130‐1005)
  • DynaMag‐2 magnet (Life Technologies, cat. no. 12321D)
  • Illumina sequencer

Alternate Protocol 1: SMART‐Seq2 Single‐Cell RNA‐Seq Modified Method

  Additional Materials (also see protocol 1Basic Protocol)
  • Triton X‐100 (Sigma‐Aldrich, cat. no. T8787)
  • SUPERase‐In RNase inhibitor, 40 U/µl (Life Technologies, cat. no. AM2694)
  • 10 µM reverse transcription DNA oligonucleotide primer (custom synthesized by Integrated DNA Technologies):
    • AAGCAGTGGTATCAACGCAGAGTACT(30)VN
  • dNTP mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM) (Thermo‐Fisher, cat. no. R0192)
  • SuperScript II Reverse Transcriptase Kit (Life Technologies, cat. no. 18064‐014) containing:
    • 5× first‐strand buffer
    • 100 mM DTT
    • SuperScript II reverse transcriptase
  • 5 M betaine
  • 100 mM MgCl 2
  • 10 µM SMARTer template switching oligonucleotide (TSO, custom synthesized by Exiqon): 5′ AAGCAGTGGTATCAACGCAGAGTACATrGrG+G
  • RNase‐free water
  • KAPA HiFi HotStart PCR ReadyMix (KAPA Biosystems, cat. no. KK2601)
  • 10 µM PCR oligonucleotide primer (custom synthesized by Integrated DNA Technologies): AAGCAGTGGTATCAACGCAGAGT
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Eberwine, J. , Yeh, H. , Miyashiro, K. , Cao, Y. , Nair, S. , Finnell, R. , Zettel, M. , and Coleman, P. 1992. Analysis of gene expression in single live neurons. Proc. Natl. Acad. Sci. U.S.A. 89:3010‐3014.
   Li, H. , Handsaker, B. , Wysoker, A. , Fennell, T. , Ruan, J. , Homer, N. , Marth, G. , Abecasis, G. , Durbin, R. , and the 1000 Genome Project Data Processing Subgroup. 2009. The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics 25:2078‐2079.
   Hashimshony, T. , Wagner, F. , Sher, N. , and Yanai, I. 2012. CEL‐Seq: Single‐cell RNA‐Seq by multiplexed linear amplification. Cell Rep. 2:666‐673.
   Picelli, S. , Björklund, Å. , Faridani, O. , Sagasser, S. , Winberg, G. , and Sandberg, R. 2013. Smart‐seq2 for sensitive full‐length transcriptome profiling in single cells. Nat. Methods 10:1096‐1098.
   Sanchez‐Freire, V. , Ebert, A. , Kalisky, T. , Quake, S. , and Wu, J. 2012. Microfluidic single‐cell real‐time PCR for comparative analysis of gene expression patterns. Nat. Protoc. 7:829‐838.
   Sandberg, R. 2014. Entering the era of single‐cell transcriptomics in biology and medicine. Nat. Methods 11:22‐24.
   Shalek, A. , Satija, R. , Adiconis, X. , Gertner, R. , Gaublomme, J. , Raychowdhury, R. , Schwartz, S. , Yosef, N. , Malboeuf, C. , Lu, D. , Trombetta, J. , Gennert, D. , Gnirke, A. , Goren, A. , Hacohen, N. , Levin, J. , Park, H. , and Regev, A. 2013. Single‐cell transcriptomics reveals bimodality in expression and splicing in immune cells. Nature 498:236‐240.
   Shapiro, E. , Biezuner, T. , and Linnarsson, S. 2013. Single‐cell sequencing‐based technologies will revolutionize whole‐organism science. Nat. Rev. Genet. 14:618‐630.
   Tang, F. , Barbacioru, C. , Wang, Y. , Nordman, E. , Lee, C. , Xu, N. , Wang, X. , Bodeau, J. , Tuch, B. , Siddiqui, A. , Lao, K. , and Surani, M. 2009. mRNA‐Seq whole transcriptome analysis of a single cell. Nat. Methods 6:377‐382.
   Thorvaldsdóttir, H. , Robinson, J.T. , and Mesirov, J.P. 2012. Integrative Genomics Viewer (IGV): High‐performance genomics data visualization and exploration. Brief. Bioinform. 14:178‐192.
   Trapnell, C. , Pachter, L. , and Salzberg, L. 2009. TopHat: Discovering splice junctions with RNA‐Seq. Bioninformatics 25:1105‐1111.
   Trapnell, C. , Roberts, A. , Goff, L. , Pertea, G. , Kim, D. , Kelley, D. , Pimentel, H. , Salzberg, S. , Rinn , and Pachter, L. 2012. Differential gene and transcript expression analysis of RNA‐seq experiments with TopHat and Cufflinks. Nat. Protoc. 7:562‐578.
   Zhu, Y. , Machleder, E. , Chenchik, A. , Li, R. , and Siebert, P. 2001. Reverse transcriptase template switching: A SMART approach for full‐length cDNA library construction. Biotechniques 30:892‐897.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library