Mapping 3′ mRNA Isoforms on a Genomic Scale

Yi Jin1, Joseph V. Geisberg1, Zarmik Moqtaderi1, Zhe Ji1, Mainul Hoque2, Bin Tian2, Kevin Struhl1

1 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts, 2 Department of Microbiology, Biochemistry and Molecular Genetics, Rutgers New Jersey Medical School, Newark, New Jersey
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.23
DOI:  10.1002/0471142727.mb0423s110
Online Posting Date:  April, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Most eukaryotic genes are transcribed into mRNAs with alternative poly(A) sites. Emerging evidence suggests that mRNA isoforms with alternative poly(A) sites can perform critical regulatory functions in numerous biological processes. In recent years, a number of strategies utilizing high‐throughput sequencing technologies have been developed to aid in the identification of genome‐wide poly(A) sites. This unit describes a modified protocol for a recently published 3′READS (3′ region extraction and deep sequencing) method that accurately identifies genome‐wide poly(A) sites and that can be used to quantify the relative abundance of the resulting 3′ mRNA isoforms. This approach minimizes nonspecific sequence reads due to internal priming and typically yields a high percentage of sequence reads that are ideally suited for accurate poly(A) identification. © 2015 by John Wiley & Sons, Inc.

Keywords: 3′ mRNA isoforms; polyadenylation; poly(A) sites; RNA sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Constructing an Indexed DNA Sequencing Library from 3′ mRNA Isoforms
  • Support Protocol 1: Sequencing Data Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Constructing an Indexed DNA Sequencing Library from 3′ mRNA Isoforms

  Materials
  • Oligo d(T) 25 magnetic beads (NEB)
  • 2× Annealing buffer (see recipe)
  • Dynabeads MyOne Streptavidin C1 (Invitrogen)
  • Beads prewash buffer (see recipe)
  • 2× Coupling buffer (see recipe)
  • Oligonucleotides (see Table 4.23.1)
  • Nuclease‐free H 2O
  • 2× Hybridization buffer (see recipe)
  • 25 μg purified total RNA (units 4.1, 4.2, 4.3, and 4.16)
  • Ice
  • RNase III digestion buffer (see recipe)
  • 1 U/μl RNase III (NEB)
  • TE buffer (see recipe)
  • Acid‐phenol:chloroform, pH 4.5 (Ambion)
  • 3 M sodium acetate, pH 5.5 (RNase‐free; appendix 22)
  • 15 mg/ml GlycoBlue (Ambion)
  • 100% (v/v), 80% (v/v), 70% (v/v) ethanol
  • High‐stringency wash buffer (see recipe)
  • RNase H digestion buffer (see recipe)
  • 5 U/μl RNase H (NEB)
  • Elution buffer (see recipe)
  • 20 U/μl SUPERase.In (Ambion)
  • 10 U/μl T4 RNA ligase 1 (NEB)
    • 10× T4 RNA ligase buffer (supplied with T4 RNA ligase 1)
    • 10 mM ATP (supplied with T4 RNA ligase 1)
    • 50% PEG8000 (supplied with T4 RNA ligase 1)
  • 200 U/μl truncated T4 RNA ligase 2 (NEB)
  • 200 U/μl SuperScript III reverse transcriptase (Invitrogen)
    • 5× First‐Strand buffer (supplied with SuperScript III reverse transcriptase)
  • 100 mM DTT (supplied with SuperScript III reverse transcriptase)
  • 12.5 and 25 mM dNTPs
  • 2 U/μl Phusion HF DNA polymerase (NEB)
  • 5× HF buffer (supplied with Phusion HF DNA polymerase)
  • DNA SizeSelector‐I (Aline)
  • High‐sensitivity DNA Kit (Agilent)
  • RNA 6000 Pico Kit (Agilent)
  • 6× Gel Loading Dye, Blue (NEB)
  • 8% TBE polyacrylamide gel (Invitrogen)
  • 10,000× SYBR Gold Nucleic Acid Gel Stain (Invitrogen)
  • TBE buffer ( appendix 22)
  • Gel extraction buffer (see recipe)
  • 10 mM Tris·Cl, pH 8 ( appendix 22)
  • 25/100 bp Mixed DNA Ladder (Bioneer)
  • 2100 Bioanalyzer system (Agilent)
  • 1.5‐ml microcentrifuge tubes (nonstick, Ambion)
  • Magnetic stand
  • Shaking platform
  • Thermal cycler
  • 37°C, 55°C, 65°C heating blocks
  • Refrigerated tabletop centrifuge
  • 0.5‐ml thin‐walled PCR tubes (non‐stick, Ambion)
  • Vortex
  • Gel electrophoresis apparatus
  • Disposable scalpel
  • Transilluminator
  • 20‐G needles
  • Costar Spin‐X centrifuge tube filter (0.45‐μm cellulose acetate in 2‐ml tube; Corning)
Table 4.3.1   MaterialsOligonucleotide Sequences

Oligonucleotides Sequence a
Biotin‐T 45U 5 b 5′‐biotin‐TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTUUUUU‐3′
Adapter A c 5′‐/5rApp/NNNNGATCGTCGGACTGTAGAACTCTGA AC/3ddC/‐3′
Primer B 5′‐GTTCAGAGTTCTACAGTCCGACGATC‐3′
Adapter C 5′‐CCUUGGCACCCGAGAAUUCCANNNN‐3′
Universal primer 5′‐AATGATACGGCGACCACCGAGATCTACACGTTCAGA GTTCTACAGTCCGA‐3′
Index primer 1 (ATCACG) 5′‐CAAGCAGAAGACGGCATACGAGATCGTGATGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 2 (CGATGT) 5′‐CAAGCAGAAGACGGCATACGAGATACATCGGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 3 (TTAGGC) 5′‐CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 4 (TGACCA) 5′‐CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 5 (ACAGTG) 5′‐CAAGCAGAAGACGGCATACGAGATCACTGTGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 6 (GCCAAT) 5′‐CAAGCAGAAGACGGCATACGAGATATTGGCGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 7 (CAGATC) 5′‐CAAGCAGAAGACGGCATACGAGATGATCTGGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 8 (ACTTGA) 5′‐CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 9 (GATCAG) 5′‐CAAGCAGAAGACGGCATACGAGATCTGATCGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 10 (TAGCTT) 5′‐CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 11 (GGCTAC) 5′‐CAAGCAGAAGACGGCATACGAGATGTAGCCGTGAC TGGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Index primer 12 (CTTGTA) 5′‐CAAGCAGAAGACGGCATACGAGATTACAAGGTGACT GGAGTTCCTTGGCACCCGAGAATTCCA‐3′
Sequencing primer 5′‐CTACACGTTCAGAGTTCTACAGTCCGACGATC‐3′
Index sequencing primer 5′‐GGAATTCTCGGGTGCCAAGGAACTCCAGTCAC‐3′
Q‐PCR checking primer F 5′‐CAAGCAGAAGACGGCATACGA‐3′
Q‐PCR checking primer R 5′‐AATGATACGGCGACCACCGAGAT‐3′

 aItalic letters represent RNA nucleotides; N's represent random nucleotides. Bold letters indicate index regions. Please note that the index sequence on each read and on each index primer shown is the reverse complement of the index sequence (in parentheses).
 bBiotin‐T 45U 5 is a chimeric DNA/RNA oligonucleotide with a standard biotin modification at the 5′ end.
 c/5rApp/ refers to 5′ adenylation and /3ddC/ refers to dideoxycytidine, a 3′ chain terminator.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Colgan, D.F. and Manley, J.L. 1997. Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11:2755‐2766.
  Derti, A., Garrett‐Engele, P., Macisaac, K.D., Stevens, R.C., Sriram, S., Chen, R., Rohl, C.A., Johnson, J.M., and Babak, T. 2012. A quantitative atlas of polyadenylation in five mammals. Genome Res. 22:1173‐1183.
  Di Giammartino, D.C., Nishida, K., and Manley, J.L. 2011. Mechanisms and consequences of alternative polyadenylation. Mol. Cell 43:853‐866.
  Elkon, R., Ugalde, A.P., and Agami, R. 2013. Alternative cleavage and polyadenylation: Extent, regulation and function. Nature reviews. Genetics 14:496‐506.
  Fox‐Walsh, K., Davis‐Turak, J., Zhou, Y., Li, H., and Fu, X.D. 2011. A multiplex RNA‐seq strategy to profile poly(A+) RNA: Application to analysis of transcription response and 3′ end formation. Genomics 98:266‐271.
  Geisberg, J.V., Moqtaderi, Z., Fan, X., Ozsolak, F., and Struhl, K. 2014. Global analysis of mRNA isoform half‐lives reveals stabilizing and destabilizing elements in yeast. Cell 156:812‐824.
  Hoque, M., Ji, Z., Zheng, D., Luo, W., Li, W., You, B., Park, J.Y., Yehia, G., and Tian, B. 2013. Analysis of alternative cleavage and polyadenylation by 3′ region extraction and deep sequencing. Nat. Methods 10:133‐139.
  Hoque, M., Li, W., and Tian, B. 2014. Accurate mapping of cleavage and polyadenylation sites by 3′ region extraction and deep sequencing. Methods Mol. Biol. 1125:119‐129.
  Jan, C.H., Friedman, R.C., Ruby, J.G., and Bartel, D.P. 2011. Formation, regulation and evolution of Caenorhabditis elegans 3′UTRs. Nature 469:97‐101.
  Jayaprakash, A.D., Jabado, O., Brown, B.D., and Sachidanandam, R. 2011. Identification and remediation of biases in the activity of RNA ligases in small‐RNA deep sequencing. Nucleic Acids Res. 39:e141.
  Ji, Z., Lee, J.Y., Pan, Z., Jiang, B., and Tian, B. 2009. Progressive lengthening of 3′ untranslated regions of mRNAs by alternative polyadenylation during mouse embryonic development. Proc. Natl. Acad. Sci. U.S.A. 106:7028‐7033.
  Mandel, C.R., Bai, Y., and Tong, L. 2008. Protein factors in pre‐mRNA 3′‐end processing. Cell. Mol. Life Sci. 65:1099‐1122.
  Mangone, M., Manoharan, A.P., Thierry‐Mieg, D., Thierry‐Mieg, J., Han, T., Mackowiak, S.D., Mis, E., Zegar, C., Gutwein, M.R., Khivansara, V., Attie, O., Chen, K., Salehi‐Ashtiani, K., Vidal, M., Harkins, T.T., Bouffard, P., Suzuki, Y., Sugano, S., Kohara, Y., Rajewsky, N., Piano, F., Gunsalus, K.C., and Kim, J.K. 2010. The landscape of C. elegans 3′UTRs. Science 329:432‐435.
  Mayr, C. and Bartel, D.P. 2009. Widespread shortening of 3′UTRs by alternative cleavage and polyadenylation activates oncogenes in cancer cells. Cell 138:673‐684.
  Moqtaderi, Z., Geisberg, J.V., Jin, Y., Fan, X., and Struhl, K. 2013. Species‐specific factors mediate extensive heterogeneity of mRNA 3′ ends in yeasts. Proc. Natl. Acad. Sci. U.S.A. 110:11073‐11078.
  Ozsolak, F., Kapranov, P., Foissac, S., Kim, S.W., Fishilevich, E., Monaghan, A.P., John, B., and Milos, P.M. 2010. Comprehensive polyadenylation site maps in yeast and human reveal pervasive alternative polyadenylation. Cell 143:1018‐1029.
  Ozsolak, F., Platt, A.R., Jones, D.R., Reifenberger, J.G., Sass, L.E., McInerney, P., Thompson, J.F., Bowers, J., Jarosz, M., and Milos, P.M. 2009. Direct RNA sequencing. Nature 461:814‐818.
  Proudfoot, N.J. 2011. Ending the message: Poly(A) signals then and now. Genes. Dev. 25:1770‐1782.
  Proudfoot, N. and O'Sullivan, J. 2002. Polyadenylation: A tail of two complexes. Curr. Biol. 12:R855‐857.
  Sandberg, R., Neilson, J.R., Sarma, A., Sharp, P.A., and Burge, C.B. 2008. Proliferating cells express mRNAs with shortened 3′ untranslated regions and fewer microRNA target sites. Science 320:1643‐1647.
  Shepard, P.J., Choi, E.A., Lu, J., Flanagan, L.A., Hertel, K.J., and Shi, Y. 2011. Complex and dynamic landscape of RNA polyadenylation revealed by PAS‐Seq. Rna 17:761‐772.
  Singh, P., Alley, T.L., Wright, S.M., Kamdar, S., Schott, W., Wilpan, R.Y., Mills, K.D., and Graber, J.H. 2009. Global changes in processing of mRNA 3′ untranslated regions characterize clinically distinct cancer subtypes. Cancer Res. 69:9422‐9430.
  Thomsen, S., Azzam, G., Kaschula, R., Williams, L.S., and Alonso, C.R. 2010. Developmental RNA processing of 3′UTRs in Hox mRNAs as a context‐dependent mechanism modulating visibility to microRNAs. Development 137:2951‐2960.
  Tian, B. and Manley, J.L. 2013. Alternative cleavage and polyadenylation: The long and short of it. Trends Biochem. Sci. 38:312‐320.
  Yoon, O.K. and Brem, R.B. 2010. Noncanonical transcript forms in yeast and their regulation during environmental stress. Rna 16:1256‐1267.
  Zhuang, F., Fuchs, R.T., Sun, Z., Zheng, Y., and Robb, G.B. 2012. Structural bias in T4 RNA ligase‐mediated 3′‐adapter ligation. Nucleic Acids Res. 40:e54.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library