Transcriptome‐Wide Identification of Pseudouridine Modifications Using Pseudo‐seq

Thomas M. Carlile1, Maria F. Rojas‐Duran1, Wendy V. Gilbert1

1 Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.25
DOI:  10.1002/0471142727.mb0425s112
Online Posting Date:  October, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A diverse array of post‐transcriptional modifications is found in RNA molecules from all domains of life. While the locations of RNA modifications are well characterized in abundant noncoding RNAs, modified sites in less abundant mRNAs are just beginning to be discovered. Recent work has revealed hundreds of previously unknown and dynamically regulated pseudouridines (Ψ) in mRNAs from diverse organisms. This unit describes Pseudo‐seq, an efficient, high‐resolution method for identification of Ψs genome‐wide. This unit includes methods for isolation of RNA from S. cerevisiae, preparation of Pseudo‐seq libraries from RNA samples, and identification of sites of pseudouridylation from the sequencing data. Pseudo‐seq is applicable to any organism or cell type, facilitating rapid identification of novel pseudouridylation events. © 2015 by John Wiley & Sons, Inc.

Keywords: RNA modification; pseudouridine; next‐generation sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Sample Preparation and RNA Isolation
  • Support Protocol 1: Isopropanol Precipitation of Nucleic Acids
  • Support Protocol 2: Regeneration of Oligo(dT) Cellulose Beads
  • Basic Protocol 2: Pseudo‐Seq Library Preparation
  • Support Protocol 3: Extraction of Nucleic Acids from Polyacrylamide Gels
  • Basic Protocol 3: Computational Analysis of Pseudo‐Seq Data
  • Support Protocol 4: Genetic Assignment of Ψs to Known Pseudouridylation Factors
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Sample Preparation and RNA Isolation

  Materials
  • YPAD (see recipe)
  • S. cerevisiae
  • Deionized, distilled H 2O
  • Liquid nitrogen
  • Acid phenol
  • AES buffer (see recipe)
  • Ice
  • Chloroform
  • 25:24:1 acid phenol:chloroform:isoamyl alcohol
  • Sodium acetate, pH 5.3
  • Isopropanol
  • 70% Ethanol
  • TES buffer (see recipe)
  • Oligo(dT) cellulose beads (NEB, cat. no. S1408)
  • TES + NaCl Buffer (see recipe)
  • 5 M NaCl
  • 1 M Tris·Cl, pH7.6
  • 0.5 M EDTA, pH 8.0
  • 20% (w/v) SDS
  • Shaking incubator
  • 2‐liter baffled flasks
  • Benchtop and refrigerated centrifuges
  • 50‐ and 15‐ml conical tubes
  • Pipets
  • Adjustable temperature water bath
  • Vortex mixer
  • Oak Ridge tubes (Thermo Scientific, cat. no. 3115‐0030)
  • Rotating rack
  • Cellulose Acetate Syringe Filters (0.45 μm)
  • 2‐ml microcentrifuge tubes
  • 200‐μl PCR tubes
  • Additional reagents for quantification of cells and nucleic acids by spectrophotometry ( ) and isopropanol precipitation of the poly(A)+ RNA with GlycoBlue ( protocol 2)

Support Protocol 1: Isopropanol Precipitation of Nucleic Acids

  Materials
  • Sample: PolyA+ RNA ( protocol 1); RNA fragments (step 4, protocol 6); gel‐purified fragments obtained (from protocol 5)
  • 3 M sodium acetate, pH 5.3
  • Isopropanol
  • GlycoBlue (Invitrogen, cat. no. AM9516)
  • 70% (v/v) ethanol
  • Microcentrifuge

Support Protocol 2: Regeneration of Oligo(dT) Cellulose Beads

  Additional Materials (also see protocol 1)
  • Used oligo(dT) cellulose beads
  • 0.1 N NaOH
  • Deionized distilled H 2O
  • TES + NaCl buffer (see recipe)

Basic Protocol 2: Pseudo‐Seq Library Preparation

  Materials
  • Total or Poly(A)+ RNA obtained from protocol 1
  • Deionized distilled H 2O
  • Ice
  • 100 mM ZnCl 2
  • 40 mM EDTA, pH 8.0
  • GlycoBlue
  • BEU buffer (see recipe)
  • CMC (Sigma, cat. no. C106402)
  • 0.5 M CMC in BEU buffer (make fresh immediately before CMC treatment)
  • 3 M sodium acetate, pH 5.3
  • Ethanol
  • Sodium carbonate buffer (see recipe)
  • 10 mM Tris·Cl, pH 8.0
  • RNasin Plus (Promega, cat. no. N2615)
  • T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201) containing:
    • 10× PNK buffer
  • Calf intestinal alkaline phosphatase (CIP; NEB, cat. no. M0290)
  • 2× RNA loading dye (see recipe)
  • 10‐bp DNA ladder (Invitrogen, cat. no. 10821‐015)
  • 0.5× TBE
  • SYBR Gold (Invitrogen, cat. no. S‐11494)
  • 3′ adapter: /5Phos/TGGAATTCTCGGGTGCCAAGG/3ddC/
  • 100 μM adenylated 3′ adapter: AppTGGAATTCTCGGGTGCCAAGG/3ddC/ (see unit )
  • T4 RNA ligase (NEB, cat. no. M0204) containing:
    • T4 RNA ligase buffer
    • PEG 8000
  • 100 μM Gel‐purified RT Primer: /5Phos/GATCGTCGGACTGTAGAACTCTGAACCTGTCGGTGGTCGCCGTATCATT/iSp18/CACTCA/iSp18/GCCTTGGCACCCGAGAATTCCA
  • 10× RT buffer without Mg2+ (see recipe)
  • 10 mM dNTPs
  • 100 mM MgCl 2
  • AMV RT (Promega, cat. no. M5108)
  • 1 N NaOH
  • 1 N HCl
  • CircLigase ssDNA ligase (Epicentre, cat. no. CL4115K)
  • 1 mM ATP
  • 50 mM MnCl 2
  • Phusion High‐Fidelity (HF) DNA polymerase (NEB, cat. no. M0530L) containing:
    • HF buffer
  • Forward PCR primer: AATGATACGGCGACCACCGA
  • Barcoded reverse PCR primers (XXXXXX Indicates unique barcodes): CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
  • 6× DNA loading dye (see recipe)
  • Thermal cycler
  • 200‐μl PCR tubes
  • Thermomixer (Eppendorf)
  • 1.5‐ml microcentrifuge tubes
  • Microcentrifuge
  • Gel electrophoresis equipment
  • Rocker platform
  • UV‐transilluminator
  • Additional reagents for the adenylation of oligonucleotides (unit ), extracting RNA from the gel slices ( protocol 5), precipitating with GlycoBlue ( protocol 2), and denaturing and nondentauring polyacrylamide gel electrophoresis (PAGE) (unit ).

Support Protocol 3: Extraction of Nucleic Acids from Polyacrylamide Gels

  Materials
  • Gel slices
  • DNA elution buffer (see recipe)
  • RNA elution buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • Rocker platform
  • Spin‐X columns (Corning, cat. no. 8162)
  • Microcentrifuge
  • Additional reagents and equipment for precipitating the filtered, eluted RNA with GlycoBlue ( protocol 2)

Basic Protocol 3: Computational Analysis of Pseudo‐Seq Data

  Materials
  • Illumina FASTQ files: The sequence files generated from an Illumina sequencing run (there should be a FASTQ file for each library submitted for sequencing)
  • S. cerevisiae Bowtie Index: Bowtie indices for common organisms are available, as are instructions for building bowtie index for a genome, which can be found in the Bowtie2 documentation
  • S. cerevisiae Splice Junctions: A TopHat readable file of splice junctions (a description of these files can be found in the TopHat documentation)
  • S. cerevisiae Transcript Annotations: Feature annotations in GFF format can be obtained from http://yeastgenome.org, and UTR boundaries can be found from published work (e.g., Xu et al., ; Arribere and Gilbert, ).
  • Python: A powerful programming language that can be used for analysis of Pseudo‐Seq data (installation instructions can be found at http://python.org; other programming languages may be substituted for Python)
  • Cutadapt: A package for trimming adapter sequences from next‐generation sequencing data (documentation can be found at https://code.google.com/p/cutadapt/)
  • Bowtie2: A package for aligning sequencing reads to a reference genome (documentation can be found at http://bowtie‐bio.sourceforge.net/bowtie2/index.shtml)
  • TopHat: A package for mapping RNA‐seq reads to splice‐junctions; note that TopHat is dependent on Bowtie and SAMtools (documentation can be found at http://ccb.jhu.edu/software/tophat/index.shtml)
  • SAMtools: A set of utilities for the manipulation of genome alignments in SAM format (documentation can be found at http://samtools.sourceforge.net/)

Support Protocol 4: Genetic Assignment of Ψs to Known Pseudouridylation Factors

  Materials
  • Pseudo‐seq libraries from yeast strains deleted for a pseudouridylation factor: Prepared as in protocol 4, analyzed as in protocol 6.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Arribere, J.A. and Gilbert, W.V. 2013. Roles for transcript leaders in translation and mRNA decay revealed by transcript leader sequencing. Genome Res. 23:977‐987. doi: 10.1101/gr.150342.112.
   Bakin, A. and Ofengand, J. 1993. Four newly located pseudouridylate residues in Escherichia coli 23 S ribosomal RNA are all at the peptidyltransferase center: Analysis by the application of a new sequencing technique. Biochemistry 32:9754‐9762. doi: 10.1021/bi00088a030.
   Cantara, W.A. , Crain, P.F. , Rozenski, J. , McCloskey, J.A. , Harris, K.A. , Zhang, X. , Vendeix, F.A.P. , Fabris, D. , and Agris, P.F. 2011. The RNA modification database, RNAMDB: 2011 update. Nucleic Acids Res. 39:D195‐D201. doi: 10.1093/nar/gkq1028.
   Carlile, T.M. , Rojas‐Duran, M.F. , Zinshteyn, B. , Shin, H. , Bartoli, K.M. , and Gilbert, W.V. 2014. Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature 515:143‐146. doi: 10.1038/nature13802.
   Charette, M. and Gray, M.W. 2000. Pseudouridine in RNA: What, where, how, and why. IUBMB Life 49:341‐351. doi: 10.1080/152165400410182.
   Choi, Y.C. and Busch, H. 1978. Modified nucleotides in T1 RNase oligonucleotides of 18 S ribosomal RNA of the Novikoff hepatoma. Biochemistry 17:2551‐2560. doi: 10.1021/bi00606a015.
   Cohn, W.E. 1960. Pseudouridine, a carbon‐carbon linked ribonucleoside in ribonucleic acids: Isolation, structure, and chemical characteristics. J. Biol. Chem. 235:1488‐1498.
   Collart, M.A. and Oliviero, S. 2001. Preparation of yeast RNA. Curr. Protoc. Mol. Biol. 23:13.12.1‐13.12.5.
   Courtes, F.C. , Gu, C. , Wong, N.S.C. , Dedon, P.C. , Yap, M.G.S. , and Lee, D.‐Y. 2014. 28 S rRNA is inducibly pseudouridylated by the mTOR pathway translational control in CHO cell cultures. J. Biotechnol. 174:16‐21. doi: 10.1016/j.jbiotec.2014.01.024.
   Davis, F.F. and Allen, F.W. 1957. Ribonucleic acids from yeast which contain a fifth nucleotide. J. Biol. Chem. 227:907‐915.
   Dominissini, D. , Moshitch‐Moshkovitz, S. , Schwartz, S. , Salmon‐Divon, M. , Ungar, L. , Osenberg, S. , Cesarkas, K. , Jacob‐Hirsch, J. , Amariglio, N. , Kupiec, M. , Sorek, R. , and Rechavi, G. 2013. Topology of the human and mouse m6A RNA methylomes revealed by m6A‐seq. Nature 485:201‐206. doi: 10.1038/nature11112.
   Fernández, I.S. , Ng, C.L. , Kelley, A.C. , Wu, G. , Yu, Y.‐T. , and Ramakrishnan, V. 2013. Unusual base pairing during the decoding of a stop codon by the ribosome. Nature 500:107‐110. doi: 10.1038/nature12302.
   Ge, J. and Yu, Y.‐T. 2013. RNA pseudouridylation: New insights into an old modification. Trends Biochem. Sci. 38:210‐218. doi: 10.1016/j.tibs.2013.01.002.
   Gilham, P.T. and Ho, N. 1971. Reaction of pseudouridine and inosine with N‐cyclohexyl‐N'‐β‐(4‐methylmorpholinium) ethylcarbodiimide. Biochemistry 10:3651‐3657. doi: 10.1021/bi00796a003.
   Gupta, R.C. and Randerath, K. 1979. Rapid print‐readout technique for sequencing of RNAs containing modified nucleotides. Nucleic Acids Res. 6:3443‐3458. doi: 10.1093/nar/6.11.3443.
   Holley, R.W. , Everett, G.A. , Madison J.T. , and Zamir, A. 1965. Nucleotide sequences in theyeast alanince transfer ribonucleic acid. J. Biol. Chem. 240:2122‐2128.
   Hudson, G.A. , Bloomingdale, R.J. , and Znosko, B.M. 2013. Thermodynamic contribution and nearest‐neighbor parameters of pseudouridine‐adenosine base pairs in oligoribonucleotides. RNA 19:1474‐1482. doi: 10.1261/rna.039610.113.
   Karijolich, J. and Yu, Y.‐T. 2011. Converting nonsense codons into sense codons by targeted pseudouridylation. Nature 474:395‐398. doi: 10.1038/nature10165.
   Li, J.B. , Levanon, E.Y. , Yoon, J.‐K. , Aach, J. , Xie, B. , Leproust, E. , Zhang, K. , Gao, Y. , and Church, G.M. 2009. Genome‐wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science 324:1210‐1213. doi: 10.1126/science.1170995.
   Lovejoy, A.F. , Riordan, D.P. , and Brown, P.O. 2014. Transcriptome‐Wide Mapping of Pseudouridines: Pseudouridine Synthases Modify Specific mRNAs in S. cerevisiae. PloS One 9:e110799. doi: 10.1371/journal.pone.0110799.
   Meyer, K.D. , Saletore, Y. , Zumbo, P. , Elemento, O. , Mason, C.E. , and Jaffrey, S.R. 2012. Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3′ UTRs and near Stop Codons. Cell 149:1635‐1646. doi: 10.1016/j.cell.2012.05.003.
   Pfeffer, S. , Lagos‐Quintana, M. , and Tuschl, T. 2005. Cloning of small RNA molecules. Curr. Protoc. Mol. Biol. 72:26.4.1‐26.4.18.
   Sambrook, J. and Russell, D.W. 2001. Molecular Cloning. CSHL Press.
   Schwartz, S. , Bernstein, D.A. , Mumbach, M.R. , Jovanovic, M. , Herbst, R.H. , León‐Ricardo, B.X. , Engreitz, J.M. , Guttman, M. , Satija, R. , Lander, E.S. , Fink, G. , and Regev, A. 2014. Transcriptome‐wide Mapping Reveals Widespread Dynamic‐Regulated Pseudouridylation of ncRNA and mRNA. Cell 159:148‐162. doi: 10.1016/j.cell.2014.08.028.
   Squires, J.E. , Patel, H.R. , Nousch, M. , Sibbritt, T. , Humphreys, D.T. , Parker, B.J. , Suter, C.M. , and Preiss, T. 2012. Widespread occurrence of 5‐methylcytosine in human coding and non‐coding RNA. Nucleic Acids Res. 40:5023‐5033. doi: 10.1093/nar/gks144.
   Subtelny, A.O. , Eichhorn, S.W. , Chen, G.R. , Sive, H. , and Bartel, D.P. 2014. Poly(A)‐tail profiling reveals an embryonic switch in translational control. Nature 508:66‐71. doi: 10.1038/nature13007.
   Tanaka, Y. , Dyer, T.A. , and Brownlee, G.G. 1980. An improved direct RNA sequence method; its application to Vida faba 5.8 S ribosomal RNA. Nucleic Acids Res. 8:1259‐1272. doi: 10.1093/nar/8.6.1259.
   Wu, G. , Xiao, M. , Yang, C. , and Yu, Y.‐T. 2011. U2 snRNA is inducibly pseudouridylated at novel sites by Pus7p and snR81 RNP. EMBO J. 30:79‐89. doi: 10.1038/emboj.2010.316.
   Xu, Z. , Wei, W. , Gagneur, J. , Perocchi, F. , Clauder‐Münster, S. , Camblong, J. , Guffanti, E. , Stutz, F. , Huber, W. , and Steinmetz, L.M. 2009. Bidirectional promoters generate pervasive transcription in yeast. Nature 457:1033‐1037. doi: 10.1038/nature07728.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library