Normalizing cDNA Libraries

Ekaterina A. Bogdanova1, Irina Shagina2, Ekaterina V. Barsova1, Ilya Kelmanson2, Dmitry A. Shagin1, Sergey A. Lukyanov1

1 Shemiakin‐Ovchinnikov Institute of Bioorganic Chemistry, Moscow, Russia, 2 Evrogen JSC, Moscow, Russia
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 5.12
DOI:  10.1002/0471142727.mb0512s90
Online Posting Date:  April, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The characterization of rare messages in cDNA libraries is complicated by the substantial variations that exist in the abundance levels of different transcripts in cells and tissues. The equalization (normalization) of cDNA is a helpful approach for decreasing the prevalence of abundant transcripts, thereby facilitating the assessment of rare transcripts. This unit provides a method for duplex‐specific nuclease (DSN)–based normalization, which allows for the fast and reliable equalization of cDNA, thereby facilitating the generation of normalized, full‐length‐enriched cDNA libraries, and enabling efficient RNA analyses. Curr. Protoc. Mol. Biol. 90:5.12.1‐5.12.27. © 2010 by John Wiley & Sons, Inc.

Keywords: cDNA normalization; duplex‐specific nuclease (DSN); normalized cDNA library

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Duplex‐Specific Nuclease (DSN)–Based Normalization of cDNA
  • Support Protocol 1: cDNA Synthesis Using the “SMART” Approach
  • Support Protocol 2: Duplex‐Specific Nuclease (DSN) Activity Testing
  • Support Protocol 3: Size Fractionation and Directional Cloning of Normalized cDNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Duplex‐Specific Nuclease (DSN)–Based Normalization of cDNA

  Materials
  • ds cDNA (700 to 1300 ng; see protocol 2)
  • QIAquick PCR Purification Kit (Qiagen)
  • 3 M sodium acetate, pH 4.8 ( appendix 22)
  • 98% (v/v) ethanol
  • 80% (v/v) ethanol
  • 1‐kb DNA ladder
  • 1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5)
  • 1× TAE buffer ( appendix 22) with and without 0.5 µg/ml ethidium bromide
  • Trimmer cDNA Normalization Kit (Evrogen; http://www.evrogen.com) including:
    • PCR primer‐M1 (10 µM): 5′‐ AAGCAGTGGTATCAACGCAGAGT‐ 3′
    • PCR primer‐M2 (10 µM): 5′‐ AAGCAGTGGTATCAACGCAG‐ 3′
    • 4× Hybridization buffer (200 mM HEPES, pH 7.5/2 M NaCl)
    • Lyophilized DSN (see recipe for preparation of 1U/µl DSN solution)
    • 2× DSN master buffer (100 mM Tris⋅Cl, pH 8.0/10 mM MgCl 2/2 mM DTT)
    • DSN storage buffer (50 mM Tris⋅Cl, pH 8.0)
    • DSN stop solution (5 mM EDTA)
  • Thermostable single‐stranded DNA binding (SSB) protein (New England Biolabs, optional)
  • Molecular biology‐grade mineral oil
  • Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
    • 50× DNA polymerase mix with 10× PCR buffer
    • dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)
  • Sterile 0.5‐ml PCR tubes (thin‐walled recommended to ensure more efficient heat transfer and maximize thermal‐cycling performance)
  • PCR thermal cycler (e.g., PTC‐200 DNA Machine, MJ Research)
  • Additional reagents agarose gel electrophoresis (unit 2.5), DSN activity testing (see protocol 3), and size fractionation and directional cloning of the normalized cDNA library (see protocol 4)
NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 1: cDNA Synthesis Using the “SMART” Approach

  Materials
  • Isolated total RNA (1 to 2 µg) or 0.5 to 1 µg of poly(A)+ RNA (see )
  • Pair of oligonucleotide adapters (10 µM each, see Fig. )
  • Molecular biology‐grade mineral oil
  • One of the following MMLV‐based reverse transcriptases: Superscript II (Invitrogen), Mint (Evrogen), or SMARTScribe (Clontech), with 5× first‐strand buffer (the authors do not recommend the use of Superscript III (Invitrogen) as, in our experience, it does not ensure effective template switching)
  • 20 mM DTT
  • Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
    • 50× DNA polymerase mix with 10× PCR buffer
    • dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)
  • 20 U/µl RNase inhibitor (optional; Ambion)
  • 20 mM MnCl 2
  • Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
    • 50× DNA polymerase mix with 10× PCR buffer
    • dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)
  • 10 µM PCR primer‐M1: 5′‐ AAGCAGTGGTATCAACGCAGAGT‐ 3′ (provided with Evrogen Trimmer cDNA Normalization Kit, http://www.evrogen.com)
  • 1‐kb DNA ladder
  • 1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5)
  • 0.2‐ ml and 0.5‐ml PCR tubes (thin‐walled recommended to ensure more efficient heat transfer and maximize thermal‐cycling performance)
  • PCR thermal cycler (e.g., PTC‐200 DNA Machine, MJ Research)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 2: Duplex‐Specific Nuclease (DSN) Activity Testing

  Materials
  • 100 ng/µl purified plasmid DNA
  • 2× DSN master buffer (see recipe; also provided with Evrogen Trimmer cDNA Normalization Kit)
  • 10× DSN solution (see recipe)
  • Molecular biology‐grade mineral oil
  • DSN storage buffer (50 mM Tris⋅Cl, pH 8.0; appendix 22; also provided with Evrogen Trimmer cDNA Normalization Kit)
  • DSN stop solution (5 mM EDTA; also provided with Evrogen Trimmer cDNA Normalization Kit)
  • 1‐kb DNA ladder
  • 1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5)
  • PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 3: Size Fractionation and Directional Cloning of Normalized cDNA

  Materials
  • 2 µg normalized cDNA (from step 38 of the protocol 1) flanked by adapter sequences comprising asymmetric SfiIA and SfiIB sites (see Fig. )
  • QIAquick PCR purification kit (Qiagen)
  • 3 M sodium acetate, pH 4.8 ( appendix 22)
  • 98% (v/v) ethanol
  • 80% (v/v) ethanol
  • 10 to 20 U/µl SfiI restriction endonuclease with 10× buffer
  • 10× (1 mg/ml) bovine serum albumin (BSA)
  • 1‐kb DNA ladder
  • 1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5)
  • 1× TAE buffer with and without 0.5 µg/ml ethidium bromide (see unit 2.5)
  • T4 DNA ligase with 10× ligation buffer (Promega)
  • Vector comprising asymmetric SfiIA and SfiIB sites; for example, pDNR‐LIB or pTriplEx2 (Clontech), linearized using SfiI restriction endonuclease
  • Chromaspin‐1000 columns (Clontech) or equivalent size‐fractionation columns
  • 14°C water bath
  • Additional reagents and equipment for phenol‐chloroform extraction of DNA (unit 2.5) and agarose gel electrophoresis (unit 2.5)
NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J.D. 1994. Molecular biology of the cell. 3rd ed. Garland Publishing, New York.
   Anisimova, V.E., Rebrikov, D.V., Shagin, D.A., Kozhemyako, V.B., Menzorova, N.I., Staroverov, D.B., Ziganshin, R., Vagner, L.L., Rasskazov, V.A., Lukyanov, S.A., and Shcheglov, A.S. 2008. Isolation, characterization and molecular cloning of duplex‐specific nuclease from the hepatopancreas of the Kamchatka crab. BMC Biochem. 21:14.
   Bogdanova, E.A., Shagina, I.A., Mudrik, E., Ivanov, I., Amon, P., Vagner, L.L., Lukyanov, S.A., and Shagin, D.A. 2009. DSN depletion is a simple method to remove selected transcripts from cDNA populations. Mol. Biotechnol. 41:247‐253.
   Calvo, E. and Ribeiro, J.M. 2006. A novel secreted endonuclease from Culex quinquefasciatus salivary glands. J. Exp. Biol. 209:2651‐2659.
   Carninci, P., Kvam, C., Kitamura, A., Ohsumi, T., Okazaki, Y., Itoh, M., Kamiya, M., Shibata, K., Sasaki, N., Izawa, M., Muramatsu, M., Hayashizaki, Y., and Schneider, C. 1996. High‐efficiency full‐length cDNA cloning by biotinylated CAP trapper. Genomics 37:327‐336.
   Carninci, P., Shibata, Y., Hayatsu, N., Sugahara, Y., Shibata, K., Itoh, M., Konno, H., Okazaki, Y., Muramatsu, M., and Hayashizaki, Y. 2000. Normalization and subtraction of cap‐trapper‐selected cDNAs to prepare full‐length cDNA libraries for rapid discovery of new genes. Genome Res. 10:1617‐1630.
   Carninci, P., Waki, K., Shiraki, T., Konno, H., Shibata, K., Itoh, M., Aizawa, K., Arakawa, T., Ishii, Y., Sasaki, D., Bono, H., Kondo, S., Sugahara, Y., Saito, R., Osato, N., Fukuda, S., Sato, K., Watahiki, A., Hirozane‐Kishikawa, T., Nakamura, M., Shibata, Y., Yasunishi, A., Kikuchi, N., Yoshiki, A., Kusakabe, M., Gustincich, S., Beisel, K., Pavan, W., Aidinis, V., Nakagawara, A., Held, W. A., Iwata, H., Kono, T., Nakauchi, H., Lyons, P., Wells, C., Hume, D. A., Fagiolini, M., Hensch, T. K., Brinkmeier, M., Camper, S., Hirota, J., Mombaerts, P., Muramatsu, M., Okazaki, Y., Kawai, J., and Hayashizaki, Y. 2003. Targeting a complex transcriptome, the construction of the mouse full‐length cDNA encyclopedia. Genome Res. 13:1273‐1289.
   Chenchik, A., Zhu, Y.Y., Diatchenko, L., Li, R., Hil, L.J., and Siebert, P.D. 1998. Gene cloning and analysis by RT‐PCR. In Biotechniques Books (P. Siebert, and J. Larrick, eds.) pp. 305‐319. Eaton Publishing, Natick, Mass.
   Chomczynski, P. and Sacchi, N. 1987. Single‐step method of RNA isolation by acid guanidinium thiocyanate‐phenol‐chloroform extraction. Anal. Biochem. 162:156‐159.
   Coche, T. and Dewez, M. 1994. Reducing bias in cDNA sequence representation by molecular selection. Nucleic Acids Res. 22:4545‐4546.
   Franz, O., Bruchhaus, I., and Roeder, T. 1999. Verification of differential gene transcription using virtual northern blotting. Nucleic Acids Res. 27:e3.
   Kunitz, M. 1950. Crystalline desoxyribonuclease; digestion of thymus nucleic. 1 acid; the kinetics of the reaction. J. Gen. Physiol. 33:363‐377.
   Liao, T.H. 1974. Bovine pancreatic deoxyribonuclease D. J. Biol. Chem. 249:2354‐2356.
   Luk'ianov, K.A., Gurskaia, N.G., Matts, M.V., Khaspekov, G.L., D'iachenko, L.B., Chenchik, A.A., Il'evich‐Stuchkov, S.G., and Luk'ianov, S.A. 1996. A method for obtaining the normalized cDNA libraries based on the effect of suppression of polymerase chain reaction. Bioorg. Khim. 22:686‐690.
   Maruyama, K. and Sugano, S. 1994. Oligo‐capping: A simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138:171‐174.
   Matz, M.V. 2003. Amplification of representative cDNA pools from microscopic amounts of animal tissue. Methods Mol. Biol. 221:103‐116.
   Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
   Schmidt, W.M. and Mueller, M.W. 1999. CapSelect: A highly sensitive method for 5′ CAP‐dependent enrichment of full‐length cDNA in PCR‐mediated analysis of mRNAs. Nucleic Acids Res. 27:e31.
   Shagin, D.A., Rebrikov, D.V., Kozhemyako, V.B., Altshuler, I.M., Shcheglov, A.S., Zhulidov, P.A., Bogdanova, E.A., Staroverov, D.B., Rasskazov, V.A., and Lukyanov, S. 2002 A novel method for SNP detection using a new duplex‐specific nuclease from crab hepatopancreas. Genome Res. 12:1935‐1942.
   Soares, M., Bonaldo, M., Jelene, P., Su, L., Lawton, L., and Efstratiadis, A. 1994. Construction and characterization of a normalized cDNA library. Proc. Natl. Acad. Sci. U.S.A. 91:9228‐9232.
   Wells, C.A., Ravasi, T., Sultana, R., Yagi, K., Carninci, P., Bono, H., Faulkner, G., Okazaki, Y., Quackenbush, J., Hume, D.A., and Lyons, P.A. 2003. Continued discovery of transcriptional units expressed in cells of the mouse mononuclear phagocyte lineage. Genome Res. 13:1360‐1365.
   Young, B.D. and Anderson, M. 1985. Quantitative analysis of solution hybridization. In Nucleic Acids Hybridisation, a Practical Spproach (B.D. Hames and S.J. Higgins, eds.) pp. 47‐71. IRL Press, Washington, D.C.
   Zhao, Y., Hoshiyama, H., Shay, J.W., and Wright, W.E. 2008. Quantitative telomeric overhang determination using a double‐strand specific nuclease. Nucleic Acids Res. 36:e14.
   Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R., and Siebert, P.D. 2001. Reverse transcriptase template switching, a SMART approach for full‐length cDNA library construction. Biotechniques 30:892‐897.
   Zhulidov, P.A., Bogdanova, E.A., Shcheglov, A.S., Vagner, L.L., Khaspekov, G.L., Kozhemyako, V.B., Matz, M.V., Meleshkevitch, E., Moroz, L.L., Lukyanov, S.A., and Shagin, D.A. 2004. Simple cDNA normalization using kamchatka crab duplex‐specific nuclease. Nucleic Acid Res. 32:e37.
   Zhulidov, P.A., Bogdanova, E.A., Shcheglov, A.S., Shagina, I.A., Wagner, L.L., Khazpekov, G.L., Kozhemyako, V.V., Lukyanov, S.A., and Shagin, D.A. 2005. A method for the preparation of normalized cDNA libraries enriched with full‐length sequences. Russ. J. Bioorganic Chem. 31:170‐177.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library