High‐Throughput Sequencing of PCR Products Tagged with Universal Primers Using 454 Life Sciences Systems

Derek Daigle1, Birgitte B. Simen1, Pascale Pochart1

1 454 Life Sciences, Branford, Connecticut
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.5
DOI:  10.1002/0471142727.mb0705s96
Online Posting Date:  October, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes a method to convert PCR products (amplicons) flanked by universal M13 primers into a library for use on all 454 Sequencing Systems (454 Life Sciences, a Roche Company). This is especially useful for simultaneous sequencing and analysis of large numbers of amplicons or for the detection of minor variations within the amplified products. The method described here involves preparing a library of DNA with specific primers containing adaptor sequences recognized by the GS Junior System sequencing process. The data from the sequencing run are processed and analyzed by 454 Life Sciences software. This approach allows for multiplexing of a large number of amplicons to streamline processing and analysis. Any pre‐existing universally tagged amplicon, primer set, or plasmid with M13 sequences flanking the cloning site can be used in this protocol. Curr. Protoc. Mol. Biol. 96:7.5.1‐7.5.14. © 2011 by John Wiley & Sons, Inc.

Keywords: high‐throughput sequencing; universally tagged libraries; M13 primers; amplicon; multiplexing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Construction of Amplicon Libraries with Universal Ends for the 454 Sequencing System
  • Alternate Protocol 1: Generation of Amplicons Tagged with Universal Sequences
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of Amplicon Libraries with Universal Ends for the 454 Sequencing System

  Materials
  • Sample DNA (Table 7.5.2; Coriell Institute for Medical Research)
  • PCR master mix (see Table 7.5.3)
  • 70% ethanol (see recipe)
  • Molecular biology grade water (Fisher Scientific, cat. no. E0032006205)
  • Agencourt AMPure XP 5 ml Kit (Beckman Coulter, cat. no. A63880)
  • 1× TE buffer, pH 7.6 to 8.0 (Fisher Scientific, cat. no. BP2474‐500)
  • Quant‐iT PicoGreen dsDNA Asay Kit (Invitrogen, cat. no. P7589)
  • Vortex mixer (Fisher Scientific)
  • 0.2‐ml tubes with caps (when using PCR tubes for PCR amplification; DOT Scientific, cat. no. 620‐PCR) or 96‐well PCR plates (when using plates for PCR amplification; Eppendorf, cat. no. 951020303)
  • 2‐ to 1000‐µl micropipets (Rainin Classic)
  • 8‐channel multichannel pipets (2 to 20 µl and 20 to 200 µl; Rainin L8‐20 and L8‐200)
  • Plate thermoseals, when using plates for PCR amplification (Thermo Scientific, cat. no. 7805)
  • Thermal cycler (Bio‐Rad, cat. nos. PTC‐0240G and ALS‐1296GC)
  • Plate centrifuge, when using plates for PCR amplification (Beckman Coulter Allegra X‐15R)
  • Round‐bottom polypropylene 96‐well plates, when using plates for PCR amplification (Fisher Scientific, cat. no. 12‐565‐502)
  • Heat block (Torrey Pines Scientific)
  • Magnetic Ring Stand (MRS): when using plates for PCR amplification (Ambion, cat. no. AM10050)
  • Magnetic Particle Concentrator (MPC): when using PCR tubes for PCR amplification (Invitrogen, cat. no. 123‐21D)
  • 1.5‐ml microcentrifuge tubes (DOT Scientific, cat. no. RN1700‐GST)
  • Microcentrifuge when using microcentrifuge tubes for PCR amplification (Fisher Scientific, cat. no. 05‐090‐100)
  • Black, flat‐bottom 96‐well microtiter plate for fluorescence assay (see your fluorometer manual)
  • Fluorometer (Molecular Devices)
    Table 7.5.3   MaterialsPCR Master Mix Composition

    Reagent 1 reaction (µl) 12 reactions (µl) Final concentration
    Forward primer (10 µM) 0.5 6 200 nM
    Reverse primer (10 µM) 0.5 6 200 nM
    dNTP mix (10 mM each) a 0.375 4.5 150 µM each
    FastStart 10× buffer #2 a 2.5 30
    FastStart Hifi polymerase (5 U/µl) a 0.4 4.8 0.08 U/µl
    MgCl 2 (25 mM) a 1.8 21.6 1.8 mM
    Molecular biology grade a water 17.93 215.1
    Total volume 24 288

     aSupplied with the FastStart Hifi PCR System (Roche, cat. no. 04738284001).

Alternate Protocol 1: Generation of Amplicons Tagged with Universal Sequences

  • Gene‐specific primers:
    • Gene‐specific primer A (forward):
    • 5′‐forward universal sequence‐ forward gene specific sequence‐3′
    • Gene‐specific primer B (reverse):
    • 5′‐reverse universal sequence‐ reverse gene specific sequence‐3′
  • PCR master mix (see Table 7.5.5)
  • Adaptor primers:
    • Adaptor primer A (forward):
    • 5′‐CGTATCGCCTCCCTCGCGCCATCAG‐MID‐forward universal sequence‐3′
    • Adaptor primer B (reverse):
    • 5′‐CTATGCGCCTTGCCAGCCCGCTCAG‐MID‐reverse universal sequence‐3′
  • Agilent Bioanalyzer 2100 (Agilent Technologies, cat. no. G2940CA)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
    Table 7.5.5   Additional Materials (also see protocol 1)   Additional MaterialsPCR Master Mix Composition

    Reagent 1 reaction (µl) 12 reactions (µl) Final concentration
    Sample DNA (5 ng/µl) 2.0 24 0.4 ng/µl
    dNTP mix (10 mM each) b 0.375 4.5 150 µM each
    FastStart 10× buffer #2 b 2.5 30
    FastStart Hifi polymerase (5 U/µl) b 0.4 4.8 0.08 U/µl
    MgCl 2 (25 mM) b 1.8 21.6 1.8 mM
    Molecular biology grade water b 16.93 203.1
    Total volume 24 288

     bSupplied with the FastStart Hifi PCR System (Roche, cat. no. 04738284001).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Budde, M.L., Wiseman, R.W., Karl, J.A., Hanczaruk, B., Simen, B.B., and O'Connor, D.H. 2010. Characterization of Mauritian cynomolgus macaque major histocompatibility complex class I haplotypes by high‐resolution pyrosequencing. Immunogenetics 62:773‐780.
   Budde, M.L., Lhost, J.J., Burwitz, B.J., Becker, E.A., Burns, C.M., O'Connor, S.L., Karl, J.A., Wiseman, R.W., Bimber, B.N., Zhang, G.L., Hildebrand, W., Brusic, V., and O'Connor, D.H. 2011. Transcriptionally abundant major histocompatibility complex class I alleles are fundamental to nonhuman primate simian immunodeficiency virus‐specific CD8+ T cell responses. J. Virol. 85:3250‐3261.
   Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka, J., Braverman, M.S., Chen, Y.J., Chen, Z., Dewell, S.B., Du, L., Fierro, J.M., Gomes, X.V., Godwin, B.C., He, W., Helgesen, S., Ho, C.H., Irzyk, G.P., Jando, S.C., Alenquer, M.L., Jarvie, T.P., Jirage, K.B., Kim, J.B., Knight, J.R., Lanza, J.R., Leamon, J.H., Lefkowitz, S.M., Lei, M., Li, J., Lohman, K.L., Lu, H., Makhijani, V.B., McDade, K.E., McKenna, M.P., Myers, E.W., Nickerson, E., Nobile, J.R., Plant, R., Puc, B.P., Ronan, M.T., Roth, G.T., Sarkis, G.J., Simons, J.F., Simpson, J.W., Srinivasan, M., Tartaro, K.R., Tomasz, A., Vogt, K.A., Volkmer, G.A., Wang, S.H., Wang, Y., Weiner, M.P., Yu, P., Begley, R.F., and Rothberg, J.M. 2005. Genome sequencing in microfabricated high‐density picolitre reactors. Nature 437:376‐380.
   Messing, J. 1993. M13 cloning vehicles. Their contribution to DNA sequencing. Methods Mol. Biol. 23:9‐12.
   Saliou, A., Delobe, L.P., Dubois, M., Nicot, F., Raymond, S., Calvez, V., Masquelier, B., and Izopet, J.: the ANRS AC11 Resistance Study Group. 2011. Concordance between two phenotypic assays and ultra deep pyrosequencing for determining HIV‐1 tropism. Antimicrob. Agents Chemother. 55:2831‐2836.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library