Polony DNA Sequencing

Gregory J. Porreca1, Jay Shendure1, George M. Church1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.8
DOI:  10.1002/0471142727.mb0708s76
Online Posting Date:  November, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Polony DNA sequencing provides an inexpensive, accurate, high‐throughput way to resequence genomes of interest by comparison to a reference genome. Mate‐paired in vitro shotgun genomic libraries are produced and clonally amplified on microbeads by emulsion PCR. These serve as templates for sequencing by fluorescent nonamer ligation reactions on a microscope slide. Each sequencing run results in millions of 26‐bp reads that can be aligned to the reference genome, allowing the identification of differences between sequences.

Keywords: DNA sequencing; high throughput; polony sequencing; resequencing; sequencing by synthesis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Construction of a Shotgun Paired‐Tag Genomic Library
  • Basic Protocol 2: Emulsion PCR of Paired‐Tag Library on Microbeads
  • Basic Protocol 3: Enrichment for Amplicon‐Bearing Beads
  • Basic Protocol 4: Casting A Polony Bead Array
  • Basic Protocol 5: DNA Sequencing by Ligation With Degenerate Fluorescent Nonamers
  • Support Protocol 1: Titration of Template for Clonal Amplification by ePCR
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of a Shotgun Paired‐Tag Genomic Library

  Materials
  • Genomic DNA
  • Buffer EB (Qiagen)
  • End‐It DNA end repair kit (Epicentre), including:
    • 10× buffer
    • 10× ATP
    • 10× dNTP mix
    • Enzyme mix
  • 10× PCR buffer without MgCl 2 (Invitrogen)
  • 50 mM MgCl 2
  • 100 mM dATP
  • 5 U/µl Taq DNA polymerase
  • 20 mg/ml glycogen
  • Oligonucleotides:
    • 100 µM T30‐T: 5′‐phosphorylated‐GTCGGAGGCCAAGGCGGCCGTACGTCCAACT‐3′ (purified by HPLC)
    • 100 µM T30‐B: 5′‐phosphorylated‐GTTGGACGTACGGCCGCCTTGGCCTCCGACT ‐3′ (purified by HPLC)
    • 1 mM N6 oligonucleotides: 5′‐NNNN*N*N‐3′ (*signifies phosphorothioate linkage; IDT)
    • 100 µM FDV‐B: 5′‐ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT‐3′ (purified by HPLC)
    • 100 µM FDV‐T: 5′‐AACCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT‐3′ (purified by HPLC)
    • 100 µM RDV‐B: 5′‐AGAGAATGAGGAACCCGGGGCAGTT‐3′ (purified by HPLC)
    • 100 µM RDV‐T: 5′‐AACTGCCCCGGGTTCCTCATTCTCT‐3′ (purified by HPLC)
  • Quick ligation kit (NEB), including:
    • 2× Quick ligation buffer
    • Quick T4 DNA ligase
  • 20 U/µl Exonuclease I (NEB)
  • 100 U/µl Exonuclease III (NEB)
  • TE buffer, pH 8.0 ( appendix 22)
  • 25 mM dNTP mix (25 mM each nucleotide)
  • 10× RepliPhi phi29 reaction buffer (Epicentre Technologies)
  • 100 U/µl RepliPhi phi29 polymerase (Epicentre)
  • 10× NEBuffer 4 (NEB)
  • 1.6 mM S‐adenosylmethionine (SAM; diluted from 32 mM stock in 1× NEBuffer 4; NEB)
  • 2 U/µl MmeI (NEB)
  • 2000 U/µl T4 DNA ligase and 10× buffer (NEB)
  • 40% (w/v) polyethylene glycol 8000 (PEG) in H 2O
  • 10× NEBuffer 2 (NEB)
  • 10 U/µl E. coli DNA polymerase I (NEB)
  • 5 U/µl Platinum Taq DNA polymerase (Invitrogen)
  • Qiaquick columns (Qiaquick PCR cleanup kit; Qiagen)
  • NanoDrop ND‐1000 spectrophotometer (NanoDrop Technologies)
  • Microcon‐30 column (Millipore)
  • Thermal cycler
  • Additional reagents and equipment for DNA quantitation ( appendix 3D), phenol/chloroform extraction and ethanol precipitation (unit 2.1), and agarose and polyacryamide gel electrophoresis (units 2.5& 2.7)

Basic Protocol 2: Emulsion PCR of Paired‐Tag Library on Microbeads

  Materials
  • MyOne C1 1‐µm paramagnetic, streptavidin‐coated beads (Dynal)
  • Bind and wash (B&W) buffer (see recipe)
  • Oligonucleotides:
    • 1 mM PR1‐F‐2BIO: 5′‐dual‐biotin‐CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT‐3′
    • 2 mM PR1‐R: 5′‐CTGCCCCGGGTTCCTCATTCTCT‐3′
    • 10 µM PR1‐3LF: 5′‐CCTCTCTATGGGCAGTCGGTGAT‐3′
  • TE buffer, pH 8.0 ( appendix 22)
  • Light mineral oil (Sigma)
  • 10% Span 80 (see recipe)
  • Tween 80
  • Triton X‐100
  • 10× PCR buffer without MgCl 2 (Invitrogen)
  • 50 mM MgCl 2
  • 25 mM dNTP mix (25 mM each nucleotide)
  • 5 U/µl Platinum Taq DNA polymerase (Invitrogen)
  • Template DNA (library DNA at appropriate concentration; see protocol 1 and protocol 6)
  • NXS buffer (see recipe)
  • 0.1 M NaOH
  • 1.5‐ml microcentrifuge tubes
  • Magnetic particle concentrator (MPC; Dynal)
  • 2‐ml cryogenic vials (Corning no. 430661)
  • Stir bar, flea‐size (VWR no. 58948‐353)
  • Magnetic stirrer (closed‐loop; VWR)
  • 200‐µl eight‐tube PCR strips
  • Thermal cycler

Basic Protocol 3: Enrichment for Amplicon‐Bearing Beads

  Materials
  • Spherotech particles (3‐µm streptavidin‐coated polystyrene particles; Spherotech no. SVP‐30‐5)
  • Bind and wash (B&W) buffer (see recipe)
  • 1 mM PR1‐BIOXL: 5′‐biotinTEG‐CGTACCCCGCTTGGTCTTTCTCCCGTACCCCGCTTGGTCTTTCTCCCTGCCCCGGGTTCCTCATTCTCT‐3′
  • TE buffer, pH 8.0 ( appendix 22)
  • ePCR beads ( protocol 2)
  • Glycerol
  • 0.1 M NaOH
  • Magnetic particle concentrator (MPC; Dynal)
  • 1.5‐ml microcentrifuge tubes

Basic Protocol 4: Casting A Polony Bead Array

  Materials
  • 1% Triton X‐100 in H 2O
  • Glacial acetic acid
  • Bind Silane (Promega)
  • 100% ethanol
  • Enriched ePCR beads in TE buffer, pH 8.0 ( protocol 3)
  • 40% acrylamide/bisacrylamide (19:1) solution
  • 5% TEMED
  • 0.5% ammonium persulfate (APS)
  • Wash 1 (see recipe)
  • Round coverslips, 40 mm diameter, no. 1.5 (Bioptechs no. 40‐1313‐0319)
  • 1000‐ml plastic beaker
  • Shaker
  • Vacuum desiccator
  • Teflon‐masked microscope slides (Erie Scientific, no. ER‐203W)

Basic Protocol 5: DNA Sequencing by Ligation With Degenerate Fluorescent Nonamers

  Materials
  • Bead array with template DNA ( protocol 4)
  • 5× tailing buffer (Invitrogen)
  • 1.25 mM ddNTP mix (1.25 mM each dideoxynucleotide)
  • 15 U/µl terminal deoxytransferase (recombinant; Invitrogen)
  • Wash 1 (see recipe)
  • 6× SSPE ( appendix 22)/0.01% Triton X‐100
  • Anchor primer (see Fig. )
  • 2000 U/µl T4 DNA ligase and 10× buffer (NEB)
  • 100 µM degenerate fluorescent nonamer mix (Integrated DNA Technologies)
  • TE buffer, pH 8.0 ( appendix 22)
  • 1 U/µl USER enzyme mix (NEB)
  • Automated fluorescent microscope with flow cell (see Table 7.8.1 for parts list)
  • Autosampler (see Table 7.8.1)
  • 1‐ml disposable syringe
  • 0.45‐µm pore size, 4‐mm cellulose acetate syringe filter (VWR)

Support Protocol 1: Titration of Template for Clonal Amplification by ePCR

  • Fluorescently labeled probes:
    • 100 µM T30‐P2‐Cy5‐A: 5′‐Cy5‐AGUUGGACGUACGGCC‐3′
    • 100 µM T30‐P2‐Cy5‐B: 5′‐Cy5‐AGUCGGAGGUCAAGGC‐3′
  • Heat block or slide thermal cycler
  • Microscope for bright‐field and fluorescence microscopy, with CCD camera and filter set for Cy5
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Diehl, F., Li, M., Dressman, D., He, Y., Shen, D., Szabo, S., Diaz, L.A. Jr., Goodman, S.N., David, K.A., Juhl, H., Kinzler, K.W., and Vogelstein, B. 2005. Detection and quantification of mutations in the plasma of patients with colorectal tumors. Proc. Natl. Acad. Sci. U.S.A. 102:16368‐16373.
   Diehl, F., Li, M., He, Y., Kinsler, K.W., Vogelstein, B., and Dressman, D. 2006. BEAMing: Single‐molecule PCR on microparticles in water‐in‐oil emulsions. Nat. Methods 3:551‐559.
   Dressman, D., Yan, H., Traverso, G., Kinzler, K.W., and Vogelstein, B. 2003. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc. Natl. Acad. Sci. U.S.A. 100:8817‐8822.
   Li, M., Diehl, F., Dressman, D., Vogelstein, B., and Kinzler, K.W. 2006. BEAMing up for detection and quantification of rare sequence variants. Nat. Methods 3:95‐97.
   Mitra, R.D. and Church, G.M. 1999. In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. 37:e34.
   Mitra, R.D., Butty, V.L., Shendure, J., Benjamin, R., Williams, B.R., Housman, D.E., and Church, G.M. 2003. Digital genotyping and haplotyping with polymerase colonies. Proc. Natl. Acad. Sci. U.S.A. 100:5926‐5931.
   Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain‐terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463‐5467.
   Shendure, J., Mitra, R.D., Varma, C., and Church, G.M. 2004. Advanced sequencing technologies: Methods and goals. Nat. Rev. Genet. 5:335‐344.
   Shendure, J., Porreca, G.J., Reppas, N.B., Lin, X., McCutcheon, J.P., Rosenbaum, A.M., Wang, M.D., Zhang, K., Mitra, R.D., and Church, G.M. 2005. Accurate multiplex polony sequencing of an evolved bacterial genome. Science 309:1728‐1732.
   Siebert, P.D., Chenchik, A., Kellogg, D.E., Lukyanov, K.A., and Lukyanov, S.A. 1995. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. 23:1087‐1088.
   Turner, D.J., Shendure, J., Porreca, G., Church, G., Green, P., Tyler‐Smith, C., and Hurles, M.E. 2006. Assaying chromosomal inversions by single‐molecule haplotyping. Nat. Methods 3:439‐445.
   Zhang, K., Zhu, J., Shendure, J., Porreca, G.J., Aach, J.D., Mitra, R.D., and Church, G.M. 2006. Long‐range polony haplotyping of individual human chromosome molecules. Nat Genet. 38:382‐387.
   Zhu, J., Shendure, J., Mitra, R.D., and Church, G.M. 2003. Single molecule profiling of alternative pre‐mRNA splicing. Science 301:836‐838 .
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library