Multiplex Illumina Sequencing Using DNA Barcoding

Koon Ho Wong1, Yi Jin1, Zarmik Moqtaderi1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.11
DOI:  10.1002/0471142727.mb0711s101
Online Posting Date:  January, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The amount of sequence obtained by modern sequencing machines greatly exceeds the sequencing depth requirements of many experiments, especially those involving organisms with small genomes. In the interest of economy and efficiency, various strategies have been developed for multiplexing, in which samples are uniquely tagged with short identifying sequences known as barcodes, pooled, and then sequenced together in a single lane. The resulting combined sequence data are subsequently sorted by barcode before bioinformatic analysis. This unit contains a barcoding protocol for the preparation of up to 96 ChIP samples for multiplex sequencing in a single flow cell lane on the Illumina platform. This strategy may be extended to even larger numbers of samples and may also be generalized to other sequencing applications or sequencing platforms. Curr. Protoc. Mol. Biol. 101:7.11.1–7.11.11. © 2013 by John Wiley & Sons, Inc.

Keywords: barcoding; multiplexing; deep sequencing; next‐generation sequencing; ChIP‐seq

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Construction of Barcoded ChIP‐seq Libraries
  • Support Protocol 1: Preparation of Barcoded Y‐Adapters
  • Support Protocol 2: DNA Purification and Size Selection Using SPRI‐Magnetic Beads
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of Barcoded ChIP‐seq Libraries

  Materials
  • 1 to 10 ng ChIP DNA (see unit 21.3)
  • Nuclease‐free water
  • 10× T4 DNA Ligase buffer
  • 10 mM dNTP mix
  • T4 DNA polymerase, 3000 U/ml (NEB)
  • T4 Polynucleotide kinase, 10,000 U/ml (NEB)
  • DNA polymerase I, large (Klenow) fragment, 5000 U/ml (NEB)
  • QIAquick PCR Purification kit (QIAGEN), or equivalent, containing Elution buffer (EB)
  • 10× NEBuffer 2 (NEB)
  • 10 mM dATP
  • Klenow Fragment (3′→5′ exo‐), 5000 U/ml (NEB)
  • QIAquick MinElute PCR Purification kit (QIAGEN)
  • 10 µM annealed Y‐adapters (from protocol 2)
  • Quick Ligation Kit (NEB) containing:
    • 2× Quick Ligation Reaction buffer
    • Quick T4 DNA ligase
  • Phusion High‐Fidelity DNA Polymerase, 2000 U/ml (NEB) containing 5× Phusion HF Reaction buffer
  • 10 µM PCR primer mix (PCR1 and PCR2; see Table 7.11.1)
  • 25 mM dNTP Mix
  • QIAquick Gel Extraction kit (QIAGEN)
  • 1.5‐ml microcentrifuge tubes
  • 37°C heat block
  • 0.5‐ml PCR tubes
  • Thermal cycler
  • Gel electrophoresis apparatus (unit 2.5)
    Table 7.1.1   MaterialsOligonucleotide Sequences for Illumina Paired‐End Y‐Adapter and PCR Primers

    Oligo Sequence
    Barcoded adapter oligo 1 (BA1) 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT‐barcode‐T 3′
    Barcoded adapter oligo 2 (BA2) 5′ p‐barcode(reverse complement)‐AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 3′ a
    PCR primer forward (PCR1) CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T b
    PCR primer reverse (PCR2) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T b

     a5′ p indicates 5′ phosphorylation.
     b*Indicates phosphorothioate bond.

Support Protocol 1: Preparation of Barcoded Y‐Adapters

  Materials
  • Oligo BA1 and BA2 (see Table 7.11.1)
  • Annealing buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • 0.5‐ml PCR tubes
  • Thermal cycler

Support Protocol 2: DNA Purification and Size Selection Using SPRI‐Magnetic Beads

  Materials
  • DNA SizeSelector‐I beads (Aline Biosciences)
  • DNA sample
  • 70% Ethanol
  • EB (from Qiaquick kit) or H 2O
  • Vortex mixer
  • 1.5‐ml microcentrifuge tubes
  • Magnetic stand
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Church, G.M. and Kieffer‐Higgins, S. 1988. Multiplex DNA sequencing. Science 240:185‐188.
   Lefrançois, P., Euskirchen, G.M., Auerbach, R.K., Rozowsky, J., Gibson, T., Yellman, C.M., Gerstein, M., and Snyder, M. 2009. Efficient yeast ChIP‐Seq using multiplex short‐read DNA sequencing. BMC Genomics 10:37.
   Meyer, M., Stenzel, U., Myles, S., Prüfer, K., and Hofreiter, M. 2007. Targeted high‐throughput sequencing of tagged nucleic acid samples. Nucleic Acids Res. 35:e97.
   Tirosh, I., Wong, K.H., Barkai, N., and Struhl, K. 2011. Extensive divergence of yeast stress responses through transitions between induced and constitutive activation. Proc. Natl. Acad. Sci. U.S.A. 108:16693–16698.
   Wong, K.H. and Struhl, K. 2011. The Cyc8‐Tup1 complex inhibits transcription primarily by masking the activation domain of the recruiting protein. Genes Dev. 25:2525–2539.
Internet Resource
   http://zarmik.hms.harvard.edu/Barcoding
  Python scripts for data pre‐processing and analysis.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library