Next‐Generation Sequencing Fragment Library Construction

Jessica Podnar1, Heather Deiderick1, Scott Hunicke‐Smith1

1 Genomic Sequencing and Analysis Facility, University of Texas at Austin, Austin, Texas
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.17
DOI:  10.1002/0471142727.mb0717s107
Online Posting Date:  July, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

All current next‐generation sequencing (NGS) platforms and applications require the sequencing library to have specific characteristics: in particular, size, size distribution, and 5′ and 3′ flanking sequences. This unit presents a robust protocol for converting a wide variety of input DNA samples into appropriate NGS libraries and discusses important considerations in experimental design, failure modes, and typical results. Curr. Protoc. Mol. Biol. 107:7.17.1‐7.17.16. © 2014 by John Wiley & Sons, Inc.

Keywords: NGS; library; libraries; sequencing; DNA; fragment; shotgun; amplicon

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Random DNA Fragmentation by Sonication
  • Basic Protocol 2: Library Construction
  • Basic Protocol 3: PCR Amplification of Library
  • Support Protocol 1: Adaptor Annealing
  • Bioinformatics Protocols
  • Support Protocol 2: Estimation of Adaptor‐Dimer Contamination
  • Support Protocol 3: Estimation of Library Size Distribution if Less than Read Length
  • Support Protocol 4: Finding Unexplained “Dominant Sequences”
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Random DNA Fragmentation by Sonication

  Materials
  • DNA sample (1 ng to 5 μg)
  • Ambion TE (Ambion, cat. no. AM9849)
  • Agencourt AMPure XP beads (Beckman Coulter, cat. no. NCC9933872)
  • 80% ethanol, freshly prepared using nuclease‐free H 2O
  • Nuclease‐free water (Ambion, cat. no. AM9932)
  • Covaris S2 with chiller unit
  • microTUBE AFA fiber pre‐slit snap‐cap, 6 × 16 mm (Covaris, cat. no. 520045)
  • VWR minifuge (cat no. 93000‐196)
  • Magnetic rack (Ambion, cat. no. AM10055)
  • Bioanalyzer 2100 (Agilent, cat. no. G2939AA) and appropriate DNA chip

Basic Protocol 2: Library Construction

  Materials
  • DNA of 1200 bp or less (fragmented in protocol 1, or amplicon of <1 to 5 μg)
  • NEBNext DNA Library Prep Master Mix for Illumina (cat. no. E6040L) containing:
    • NEBNext End Repair Enzyme Mix
    • NEBNext End Repair Reaction Buffer (10×)
    • Klenow Fragment (3′→ 5′ exo–)
    • NEBNext dA‐Tailing Reaction Buffer (10×)
    • Quick T4 DNA Ligase
    • NEBNext Quick Ligation Reaction Buffer (5×)
    • Phusion High‐Fidelity PCR Master Mix with HF Buffer (2×)
  • Nuclease‐free water (Ambion, cat. no. AM9932)
  • Qiagen MinElute PCR purification kit (cat. no. 28006) containing:
    • MinElute Spin Columns
    • Collection Tubes
    • Buffer PB
    • Buffer PE
    • Buffer EB
    • pH indicator
  • Illumina Barcode Adaptors, 50 μM (see protocol 4)
  • Agencourt AMPure XP beads (Beckman Coulter, cat. no. NCC9933872)
  • 80% ethanol, freshly prepared with nuclease‐free H 2O
  • Magnetic rack (Ambion, cat. no. AM10055)

Basic Protocol 3: PCR Amplification of Library

  Materials
  • DNA from protocol 2
  • NEBNext DNA Library Prep Master Mix for Illumina (cat. no. E6040L) reagents:
    • Phusion High‐Fidelity PCR Master Mix with HF Buffer (2×)
    • 25 μM Illumina PCR primer 1 (IDT): CAAGCAGAAGACGGCATACGAG
    • 25 μl Illumina PCR primer 2 (IDT): AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA (note that these oligonucleotides may be provided in certain vendor kits and may differ in length from these sequences)
  • 80% ethanol, freshly prepared with nuclease‐free H 2O
  • Agencourt AMPure XP beads (Beckman Coulter, cat. no. NCC9933872)
  • Nuclease‐free water (Ambion, cat. no. AM9932)
  • Calibrated fluorescence assay kit, e.g., Picogreen or Qubit (optional; Life Technologies)
  • Thermal cycler
  • Magnetic rack (Ambion, cat. no. AM10055)
  • Bioanalyzer 2100 (Agilent, cat. no. G2939AA) and appropriate DNA chip
  • Additional reagents and equipment for PCR (unit 15.1)

Support Protocol 1: Adaptor Annealing

  Materials
  • Oligonucleotides, stored at −20°C at 100 μM in 1× TE buffer, pH 8.0 (Ambion):
    • Oligonucleotide 1, “Universal” (5′‐3′): AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    • Oligonucleotide 2, “Index‐specific” (5′‐3′):
    • GATCGGAAGAGCACACGTCTGAACTCCAGTCAC‐NNNNNN‐ATCTCGTATGCCGTCTTCTGCTTG (where “NNNNNN”, the user‐selected barcode or index segment, may be any sequence chosen by the user, but should comply with Illumina guidelines for nucleotide composition and base diversity during sequencing).
  • 1× TE buffer, pH 8.0 (Life Technologies, cat. o. AM9849)
  • 5 M NaCl (Life Technologies, Cat No. AM9760G)
  • 0.2‐ml PCR tube strips
  • Thermal cycler
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Aird, D., Ross, M.G., Chen W.S., Danielsson, M., Fennell, T., Russ, C., Jaffe, D.B., Nusbaum, C., and Gnirke, A. 2011. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Biol. 12:R18.
  Butler, J., MacCallum, I., Kleber, M., Shlyakhter, I.A., Belmonte, M.K., Lander, E.S., Nusbaum, C., and Jaffe, D.B. 2008. ALLPATHS: De novo assembly of whole‐genome shotgun microreads. Genome Res. 18:810‐820.
  Clark, J.M. 1988. Novel non‐templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16:9677‐9686.
  Deininger, P.L. 1983. Random subcloning of sonicated DNA: Application to shotgun DNA sequence analysis. Anal. Biochem. 129:216‐223.
  Oyola, S.O., Otto, T.D., Gu, Y., Maslen, G., Manske, M., Campino, S., Turner, D.J., Macinnis, B., Kwiatkowski, D.P., Swerdlow, H.P., and Quail, M.A. 2012. Optimizing illumina next‐generation sequencing library preparation for extremely AT‐biased genomes. BMC Genomics 13:1.
  Roe, B.A., Crabtree, J.S., and Khan, A.S. 1996. DNA Isolation and Sequencing (Essential Techniques Series). John Wiley & Sons, New York.
  Zhou, M.Y. and Gomez‐Sanchez, C.E. 2000. Universal TA cloning. Curr. Issues Mol. Biol. 2:1‐7.
Internet Resources
  http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  FastQC.
  http://www.kapabiosystems.com/products/name/kapa‐library‐quant‐kits
  Kapa Biosystems: Library Quant Kit (cat no. KK4824).
  http://www.perkinelmer.com/Catalog/Product/ID/760541
  LabChip XT system.
  http://www.sagescience.com/
  Pippin prep system.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library