Next‐Gen Sequencing‐Based Mapping and Identification of Ethyl Methanesulfonate‐Induced Mutations in Arabidopsis thaliana

Xue‐Cheng Zhang1, Yves Millet2, Frederick M. Ausubel1, Mark Borowsky1

1 Department of Genetics, Harvard Medical School and Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts, 2 Symbiota, Inc, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.18
DOI:  10.1002/0471142727.mb0718s108
Online Posting Date:  October, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Forward genetic analysis using ethyl methanesulfonate (EMS) mutagenesis has proven to be a powerful tool in biological research, but identification and cloning of causal mutations by conventional genetic mapping approaches is a painstaking process. Recent advances in next‐gen sequencing have greatly invigorated the process of identifying EMS‐induced mutations corresponding to a specific phenotype in model genetic hosts, including the plant Arabidopsis thaliana and the nematode Caenorhabditis elegans. Next‐gen sequencing of bulked F2 mutant recombinants produces a wealth of high‐resolution genetic data, provides enhanced delimitation of the genomic location of mutations, and greatly reduces hands‐on time while maintaining high accuracy and reproducibility. In this unit, a detailed procedure to simultaneously map and identify EMS mutations in Arabidopsis is described. Curr. Protoc. Mol. Biol. 108:7.18.1‐7.18.16. © 2014 by John Wiley & Sons, Inc.

Keywords: next‐gen sequencing; genetic mapping; ethyl methanesulfonate (EMS)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Young Arabidopsis leaves
  • Liquid nitrogen
  • Hexadecyltrimethylammonium bromide (CTAB) extraction buffer (see recipe)
  • 2‐mercaptoethanol
  • 10 mg/ml protease K
  • 25:24:1 phenol/chloroform/isoamyl alcohol, pH 8.0
  • Isopropanol
  • 70% and 80% ethanol
  • TE buffer, pH 8.0 (see recipe)
  • 10 mg/ml RNase A
  • 4 M LiCl
  • 600 U/ml T4 DNA ligase and ligation buffer
  • dNTPs, 10 mM each
  • 10,000 U/ml T4 polynucleotide kinase
  • 3000 U/ml T4 DNA polymerase
  • 5000 U/ml Klenow DNA polymerase (large fragment)
  • PCR purification kit (QIAquick, Qiagen)
  • 10× NEB no. 2 buffer
  • dATP, 100 mM
  • 5000 U/ml Klenow fragment, 3′‐5′ exo‐
  • 100 μM adapter 1: 5′ACACTCTTTCCCTACACGACGCTCTTCCGATC*T3′
  • 100 μM adapter 2: 5′5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC3′
  • Low‐melting‐point agarose
  • 10 mg/ml ethidium bromide
  • 1× TAE buffer
  • 6× DNA loading dye
  • 50‐bp DNA ladder
  • QIAquick gel extraction kit
  • 2× Phusion HF Mastermix (NEB)
  • Universal PCR primer: 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T3′
  • Index PCR primer 1: 5′CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T3′
  • Index PCR primer 2: 5′CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T3′
  • High‐sensitivity DNA reagents
  • 0.5‐, 1.5‐, and 2‐ml microcentrifuge tubes
  • Plastic pestle or tissuelyzer
  • Vortexer
  • 55°C incubator
  • Benchtop and refrigerated centrifuges
  • NanoDrop microvolume spectrophotometer ( appendix 3J)
  • Covaris S2 sonicator
  • DNA sonication tube, e.g., Covaris MicroTube (6 × 16–mm) AFA fiber with snap‐cap round‐bottom glass tube
  • Thermal cycler
  • AMPure XP purification beads (Agencourt)
  • Magnetic separation stand
  • Scalpel
  • UV transilluminator
  • Agilent Bioanalyzer 2100
  • Additional reagents and equipment for DNA concentration measurements ( appendix 3J) and agarose gel electrophoresis (unit 2.5)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abe, A., Kosugi, S., Yoshida, K., Natsume, S., Takagi, H., Kanzaki, H., Matsumura, H., Mitsuoka, C., Tamiru, M., Innan, H., Cano, L., Kamoun, S., and Terauchi, R. 2012. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 30:174‐178.
  Ashelford, K., Eriksson, M.E., Allen, C.M., D'Amore, R., Johansson, M., Gould, P., Kay, S., Millar, A.J., Hall, N., and Hall, A. 2011. Full genome re‐sequencing reveals a novel circadian clock mutation in Arabidopsis. Genome Biol. 12:R28.
  Austin, R.S., Vidaurre, D., Stamatiou, G., Breit, R., Provart, N.J., Bonetta, D., Zhang, J., Fung, P., Gong, Y., Wang, P.W., McCourt, P., and Guttman, D.S. 2011. Next‐generation mapping of Arabidopsis genes. Plant J. 67:715‐725.
  Blumenstiel, J.P., Noll, A.C., Griffiths, J.A., Perera, A.G., Walton, K.N., Gilliland, W.D., Hawley, R.S., and Staehling‐Hampton, K. 2009. Identification of EMS‐induced mutations in Drosophila melanogaster by whole‐genome sequencing. Genetics 182:25‐32.
  Clark, R.M., Schweiker, G., Toomajian, C., Ossowski, S., Zeller, G., Shinn, P., Warthmann, N., Hu, T.T., Fu, G., Hinds, D.A., Chen, H., Frazer, K.A., Huson, D.H., Scholkopf, B., Nordborg, M., Ratsch, G., Ecker, J.R., and Weigel, D. 2007. Common sequence polymorphisms shaping genetic diversity in Arabidopsis thaliana. Science 317:338‐342.
  Cuperus, J.T., Montgomery, T.A., Fahlgren, N., Burke, R.T., Townsend, T., Sullivan, C.M., and Carrington, J.C. 2010. Identification of MIR390a precursor processing‐defective mutants in Arabidopsis by direct genome sequencing. Proc. Natl. Acad. Sci. U.S.A. 107:466‐471.
  Hartwig, B., James, G.V., Konrad, K., Schneeberger, K., and Turck, F. 2012. Fast isogenic mapping‐by‐sequencing of ethyl methanesulfonate‐induced mutant bulks. Plant Physiol. 160:591‐600.
  Liu, K.H., McCormack, M., and Sheen, J. 2012. Targeted parallel sequencing of large genetically‐defined genomic regions for identifying mutations in Arabidopsis. Plant Methods 8:12.
  Michelmore, R.W., Paran, I., and Kesseli, R.V. 1991. Identification of markers linked to disease‐resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. U.S.A 88:9828‐9832.
  Millet, Y.A., Danna, C.H., Clay, N.K., Songnuan, W., Simon, M.D., Werck‐Reichhart, D., and Ausubel, F.M. 2010. Innate immune responses activated in Arabidopsis roots by microbe‐associated molecular patterns. Plant Cell 22:973‐990.
  Sarin, S., Prabhu, S., O'Meara, M.M., Pe'er, I., and Hobert, O. 2008. Caenorhabditis elegans mutant allele identification by whole‐genome sequencing. Nat. Methods 5:865‐867.
  Schneeberger, K., Ossowski, S., Lanz, C., Juul, T., Petersen, A.H., Nielsen, K.L., Jorgensen, J.E., Weigel, D., and Andersen, S.U. 2009. SHOREmap: Simultaneous mapping and mutation identification by deep sequencing. Nat. Methods 6:550‐551.
  Smith, D.R., Quinlan, A.R., Peckham, H.E., Makowsky, K., Tao, W., Woolf, B., Shen, L., Donahue, W.F., Tusneem, N., Stromberg, M.P., Stewart, D.A., Zhang, L., Ranade, S.S., Warner, J.B., Lee, C.C., Coleman, B.E., Zhang, Z., McLaughlin, S.F., Malek, J.A., Sorenson, J.M., Blanchard, A.P., Chapman, J., Hillman, D., Chen, F., Rokhsar, D.S., McKernan, K.J., Jeffries, T.W., Marth, G.T., and Richardson, P.M. 2008. Rapid whole‐genome mutational profiling using next‐generation sequencing technologies. Genome Res. 18:1638‐1642.
  Zuryn, S., Le Gras, S., Jamet, K., and Jarriault, S. 2010. A strategy for direct mapping and identification of mutations by whole‐genome sequencing. Genetics 186:427‐430.
Key References
  Cuperus, J.T., Montgomery, T.A., Fahlgren, N., Burke, R.T., Townsend, T., Sullivan, C.M., and Carrington, J.C. 2010. Identification of MIR390a precursor processing‐defective mutants in Arabidopsis by direct genome sequencing. Proc. Natl. Acad. Sci. U.S.A. 107:466‐471.
  This is a pioneering study that outlined the framework of genome resequencing‐based cloning of EMS mutations in Arabidopsis and provided technical details and computational scripts.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library