A Microbiome DNA Enrichment Method for Next‐Generation Sequencing Sample Preparation

Erbay Yigit1, George R. Feehery1, Bradley W. Langhorst1, Fiona J. Stewart1, Eileen T. Dimalanta1, Sriharsa Pradhan1, Barton Slatko1, Andrew F. Gardner1, James McFarland1, Christine Sumner1, Theodore B. Davis1

1 New England Biolabs, Ipswich, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 7.26
DOI:  10.1002/cpmb.12
Online Posting Date:  July, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

“Microbiome” is used to describe the communities of microorganisms and their genes in a particular environment, including communities in association with a eukaryotic host or part of a host. One challenge in microbiome analysis concerns the presence of host DNA in samples. Removal of host DNA before sequencing results in greater sequence depth of the intended microbiome target population. This unit describes a novel method of microbial DNA enrichment in which methylated host DNA such as human genomic DNA is selectively bound and separated from microbial DNA before next‐generation sequencing (NGS) library construction. This microbiome enrichment technique yields a higher fraction of microbial sequencing reads and improved read quality resulting in a reduced cost of downstream data generation and analysis. © 2016 by John Wiley & Sons, Inc.

Keywords: DNA sequencing; microbiome; metagenomics DNA enrichment; methylation; next‐generation sequencing; NGG; target enrichment

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Microbiome DNA Enrichment for Next‐Generation Sequencing Sample Preparation
  • Alternate Protocol 1: Eluting Captured Host DNA
  • Alternate Protocol 2: Ethanol Precipitation of DNA
  • Alternate Protocol 3: Quantitation and Validation of Enrichment by Agarose Gel Electrophoresis
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Microbiome DNA Enrichment for Next‐Generation Sequencing Sample Preparation

  Materials
  • Sample: DNA samples should be in 1× TE buffer, be free of proteins, proteinase, SDS and organic solvents, be at least 15 kb or greater in size and free of small molecular weight fragments
  • DNA marker (Lambda DNA‐HindIII Digest, NEB, cat. no. N3012)
  • 6× Gel Loading Dye Blue (NEB, cat. no. B7021)
  • NEBNext kit (NEB, cat. no. E2612) containing:
    • NEBNext protein A magnetic beads
    • NEBNext MBD2‐Fc protein
    • NEBNext Bind/wash buffer (5×)
    • 16S rRNA universal gene bacterial control primers (20 μM each)
    • 5‐CCATGAAGTCGGAATCGCTAG (forward)
    • 5‐GCTTGACGGGCGGTGT (reverse)
  • RPL30 human DNA control primers (20 μM each)
    • 5‐GCCCGTTCAGTCTCTTCGATT (forward)
  • 5‐CAAGGCAAAGCGAAATTGGT (reverse)
  • Ice
  • Nuclease‐free water
  • Agencourt AMPure XP beads
  • 80% ethanol (freshly prepared)
  • 1× TE buffer (10 mM Tris·Cl, pH 7.5, 1 mM EDTA)
  • qPCR reagent kit (Bio‐Rad, cat. no. 172‐5120)
  • Rotating mixer (Thermo Scientific)
  • Eppendorf DNA LoBind microcentrifuge tubes
  • Microcentrifuge
  • 6‐tube magnetic separation rack (e.g., NEB, cat. no. S1506)
  • Thermal cycler (e.g., Bio‐Rad CFX96 Touch Real‐Time PCR Detection System or similar)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5, Voytas, ), quantifying DNA using a spectrophotometer ( appendix 3D, Gallagher and Dejardins, ) and using a Nanodrop instrument (APPENDI , Dejardins and Conklin, )
NOTE: It is important to use sterile technique to avoid bacterial growth in reagents and environmental DNA contamination during the enrichment process.NOTE: It is also recommended that reagents be stored at ‐20°C, except Protein A beads (4°C storage), to minimize DNA contamination from environmental bacteria. Reagents stored at 4°C or room temperature (25°C) can support bacterial growth.

Alternate Protocol 1: Eluting Captured Host DNA

  Additional Materials (also see protocol 1Basic Protocol)
  • Proteinase K (800 U/ml)
  • Vortex mixer
  • Waterbath or thermomixer set to 65°C
  • Microcentrifuge

Alternate Protocol 2: Ethanol Precipitation of DNA

  Additional Materials (also see protocol 1Basic Protocol)
  • 100% ethanol

Alternate Protocol 3: Quantitation and Validation of Enrichment by Agarose Gel Electrophoresis

  Materials
  • 6× Gel Loading Dye blue
  • λ DNA‐Hind III Digest
  • Agarose for large fragment analysis
  • Agarose gel electrophoresis apparatus
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Auburn, S., Campino, S., Clark, T.G., Djimde, A.A., Zongo, I., Pinches, R., Manske, M., Mangano, V., Alcock, D., Anastasi, E., Maslen, G., Macinnis, B., Rockett, K., Modiano, D., Newbold, C.I., Doumbo, O.K., Ouedraogo, J.B., and Kwiatkowski, D.P. 2011. An effective method to purify Plasmodium falciparum DNA directly from clinical blood samples for whole genome high‐throughput sequencing. PLoS One 6:e22213. doi: 10.1371/journal.pone.0022213.
  Backhed, F., Ley, R.E., Sonnenburg, J.L., Peterson, D.A., and Gordon, J.I. 2005. Host‐bacterial mutualism in the human intestine. Science 307:1915‐1920. doi: 10.1126/science.1104816.
  Bright, A.T., Tewhey, R., Abeles, S., Chuquiyauri, R., Llanos‐Cuentas, A., Ferreira, M.U., Schork, N.J., Vinetz, J.M., and Winzeler, E.A. 2012. Whole genome sequencing analysis of Plasmodium vivax using whole genome capture. BMC Genomics 13:262. doi: 10.1186/1471‐2164‐13‐262.
  Desjardins, P.R. and Conklin, D.S. 2011. Microvolume quantitation of nucleic acids. Curr. Protoc. Mol. Biol. 93:A.3J.1‐A.3J.16. doi: 10.1002/0471142727.mba03js93.
  Feehery, G.R., Yigit, E., Oyola, S.O., Langhorst, B.W., Schmidt, V.T., Stewart, F.J., Dimalanta, E.T., Amaral‐Zettler, L.A., Davis, T., Quail, M.A., and Pradhan, S. 2013. A method for selectively enriching microbial DNA from contaminating vertebrate host DNA. PLoS One 8:e76096. doi: 10.1371/journal.pone.0076096.
  Fierer, N., Lauber, C.L., Zhou, N., McDonald, D., Costello, E.K., and Knight, R. 2010. Forensic identification using skin bacterial communities. Proc. Natl. Acad. Sci. U.S.A. 107:6477‐6481. doi: 10.1073/pnas.1000162107.
  Gallagher, S.R. and Desjardins, P.R. 2006. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 76:A.3D.1‐A.3D.21.
  Gebhard, C., Schwarzfischer, L., Pham, T.H., Andreesen, R., Mackensen, A., and Rehli, M. 2006. Rapid and sensitive detection of CpG‐methylation using methyl‐binding (MB)‐PCR. Nucleic Acids Res. 34:e82. doi: 10.1093/nar/gkl437.
  Glasel, J.A. 1995. Validity of nucleic acid purities monitored by 260 nm/280 nm absorbance ratios. Biotechniques 18:62‐63.
  Green, M.R. and Sambrook, J. 2012. Molecular cloning: a laboratory manual, 4 ed., vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  Horz, H.P., Scheer, S., Vianna, M.E., and Conrads, G. 2010. New methods for selective isolation of bacterial DNA from human clinical specimens. Anaerobe 16:47‐53. doi: 10.1016/j.anaerobe.2009.04.009.
  Huberman, J.A. 1995. Importance of measuring nucleic acid absorbance at 240 nm as well as at 260 and 280 nm. Biotechniques 18:636.
  Jansson, J.K. and Prosser, J.I. 2013. Microbiology: The life beneath our feet. Nature 494:40‐41. doi: 10.1038/494040a.
  Lister, R., Pelizzola, M., Dowen, R.H., Hawkins, R.D., Hon, G., Tonti‐Filippini, J., Nery, J.R., Lee, L., Ye, Z., Ngo, Q.M., Edsall, L., Antosiewicz‐Bourget, J., Stewart, R., Ruotti, V., Millar, A.H., Thomson, J.A., Ren, B., and Ecker, J.R. 2009. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462:315‐322. doi: 10.1038/nature08514.
  Manchester, K.L. 1995. Value of A260/A280 ratios for measurement of purity of nucleic acids. Biotechniques 19:208‐210.
  Manchester, K.L. 1996. Use of UV methods for measurement of protein and nucleic acid concentrations. Biotechniques 20:968‐970.
  Morgan, X.C., Segata, N., and Huttenhower, C. 2013. Biodiversity and functional genomics in the human microbiome. Trends Genet. 29:51‐58. doi: 10.1016/j.tig.2012.09.005.
  NIH HMP Working Group, Peterson, J., Garges, S., Giovanni, M., McInnes, P., Wang, L., Schloss, J.A., Bonazzi, V., McEwen, J.E., Wetterstrand, K.A., Deal, C., Baker, C.C., Di Francesco, V., Howcroft, T.K., Karp, R.W., Lunsford, R.D., Wellington, C.R., Belachew, T., Wright, M., Giblin, C., David, H., Mills, M., Salomon, R., Mullins, C., Akolkar, B., Begg, L., Davis, C., Grandison, L., Humble, M., Khalsa, J., Little, A.R., Peavy, H., Pontzer, C., Portnoy, M., Sayre, M.H., Starke‐Reed, P., Zakhari, S., Read, J., Watson, B., and Guyer, M. 2009. The NIH human microbiome project. Genome Res. 19:2317‐2323. doi: 10.1101/gr.096651.109.
  Oyola, S.O., Gu, Y., Manske, M., Otto, T.D., O'Brien, J., Alcock, D., Macinnis, B., Berriman, M., Newbold, C.I., Kwiatkowski, D.P., Swerdlow, H.P., and Quail, M.A. 2013. Efficient depletion of host DNA contamination in malaria clinical sequencing. J. Clin. Microbiol. 51:745‐751. doi: 10.1128/JCM.02507-12.
  Pflughoeft, K.J. and Versalovic, J. 2012. Human microbiome in health and disease. Annu. Rev. Pathol. 7:99‐122. doi: 10.1146/annurev‐pathol‐011811‐132421.
  Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K.S., Manichanh, C., Nielsen, T., Pons, N., Levenez, F., Yamada, T., Mende, D.R., Li, J., Xu, J., Li, S., Li, D., Cao, J., Wang, B., Liang, H., Zheng, H., Xie, Y., Tap, J., Lepage, P., Bertalan, M., Batto, J.M., Hansen, T., Le Paslier, D., Linneberg, A., Nielsen, H.B., Pelletier, E., Renault, P., Sicheritz‐Ponten, T., Turner, K., Zhu, H., Yu, C., Li, S., Jian, M., Zhou, Y., Li, Y., Zhang, X., Li, S., Qin, N., Yang, H., Wang, J., Brunak, S., Dore, J., Guarner, F., Kristiansen, K., Pedersen, O., Parkhill, J., Weissenbach, J., Meta, H.I.T.C., Bork, P., Ehrlich, S.D., and Wang, J. 2010. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464:59‐65. doi:10.1038/nature08821.
  Salter, S.J., Cox, M.J., Turek, E.M., Calus, S.T., Cookson, W.O., Moffatt, M.F., Turner, P., Parkhill, J., Loman, N.J., and Walker, A.W. 2014. Reagent and laboratory contamination can critically impact sequence‐based microbiome analyses. BMC Biol. 12:87. doi: 10.1186/s12915‐014‐0087‐z.
  Tucker, K.L. 2001. Methylated cytosine and the brain: A new base for neuroscience. Neuron 30:649‐652. doi:10.1016/S0896‐6273(01) 00325‐7.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Weiss, S., Amir, A., Hyde, E.R., Metcalf, J.L., Song, S.J., and Knight, R. 2014. Tracking down the sources of experimental contamination in microbiome studies. Genome Biol. 15:564.
  Yigit, E., Hernandez, D.I., Trujillo, J.T., Dimalanta, E., and Bailey, C.D. 2014. Genome and metagenome sequencing: Using the human methyl‐binding domain to partition genomic DNA derived from plant tissues. Appl. Plant Sci. 2:1400064.
  Zheng, Z., Deng, X., and Chen, J. 2014. Whole‐Genome Sequence of “Candidatus Liberibacter asiaticus” from Guangdong, China. Genome Announc. 2:e00273‐14. doi: 10.1128/genomeA.00273‐14.
Internet Resources
  https://www.neb.com/products/e2612‐nebnext‐microbiome‐dna‐enrichment‐kit
  Updated information on the DNA enrichment kit may be found at the above Web site.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library