Directed Mutagenesis Using the Polymerase Chain Reaction

Brendan Cormack1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 8.5
DOI:  10.1002/0471142727.mb0805s37
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit contains two basic protocols for introducing base changes into specific DNA sequences. The first describes the incorporation of a restriction site and the second details the generation of specific point mutations. An describes generating point mutations by sequential PCR steps. Although the general procedure is the same in all three protocols, there are differences in the design of the synthetic oligonucleotide primers and in the subsequent cloning and analyses of the amplified fragments.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Introduction of Restriction Endonuclease Sites by PCR
  • Basic Protocol 2: Introduction of Point Mutations by PCR
  • Alternate Protocol 1: Introduction of a Point Mutation by Sequential PCR Steps
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Introduction of Restriction Endonuclease Sites by PCR

  Materials
  • DNA sample to be mutagenized
  • pUC19 plasmid vector ( Figure 1.5.2) or similar high‐copy‐number plasmid having M13 flanking primer sequences
  • TE buffer ( appendix 22)
  • 10× MgCl 2‐free PCR amplification buffer (unit 15.1) supplemented with MgCl 2 as appropriate (see step )
  • 2 mM 4dNTP mix (unit 15.1)
  • 500 ng/µl (100 pmol/µl) M13 forward and reverse flanking sequence primers (New England Biolabs)
  • 5 U/µl Taq DNA polymerase (units 15.1 & 3.5)
  • Mineral oil
  • Chloroform (unit 2.1)
  • Buffered phenol (unit 2.1)
  • 100% ethanol
  • Appropriate restriction endonucleases (Table 8.5.1)
  • 500‐µl microcentrifuge tube
  • Automated thermal cycler
  • Additional reagents and equipment for subcloning DNA (unit 3.16), plasmid DNA miniprep (unit 1.6), synthesis and purification of oligonucleotides (units 2.11 & 2.12), PCR amplification (unit 15.1), DNA extraction and precipitation (unit 2.1), quantitation of DNA by absorbance spectrometry ( 3.NaN), restriction endonuclease digestion (unit 3.1), agarose and polyacrylamide gel electrophoresis of DNA (units 2.5 & 2.7), purification of DNA from low gelling/ melting agarose gels (unit 2.6), ligation of DNA fragments (unit 3.16), transformation of E. coli (unit 1.8), and DNA sequence analysis (unit 7.4)
    Table 8.5.1   Materials   Relative Efficiencies of Restriction Enzyme Cleavage When Restriction Site is Near End of DNA Fragment a   Relative Efficiencies of Restriction Enzyme Cleavage When Restriction Site is Near End of DNA Fragment

    Enzyme Oligo sequence   % cleavage
    2 hr 20 hr
    AflIII CCACATGTGG >90 >90
    AscI GGCGCGCC >90 >90
    AvaI CCCCCGGGGG >90 >90
    BamHI CGGGATCCCG >90 >90
    BglII GAAGATCTTC 75 >90
    BssHII TTGGCGCGCCAA 50 >90
    BstEII GGGT(A/T)ACCC 0 10
    BstXI CTGCAGAACCAATGCATTGGATGCAT 25 >90
    ClaI CCATCGATGG >90 >90
    EcoRI GGAATTCC >90 >90
    HaeIII GGGGCCCC >90 >90
    HindIII CCCAAGCTTGGG 10 75
    KpnI GGGGTACCCC >90 >90
    MluI CGACGCGTCG 25 50
    NcoI CATGCCATGGCATG 50 75
    NdeI GGAATTCCATATGGAATTCC 75 90
    NheI CTAGCTAGCTAG 10 50
    NotI AAGGAAAAAAGCGGCCGCAAAAGGAAAA 25 >90
    NsiI CCAATGCATTGGTTCTGCAGTT >90 >90
    PacI CCTTAATTAAGG 0 >90
    PmeI AGCTTTGTTTAAACGGCGCGCCGG 75 >90
    PstI AAAACTGCAGCCAATGCATTGGAA >90 >90
    PvuI ATCGATCGAT 10 25
    SacI CGAGCTCG 10 10
    SacII TCCCCGCGGGGA 50 90
    SalI ACGCGTCGACGTCGGCCATAGCGGCCGCGGAA 10 75
    ScaI AAAAGTACTTTT 75 75
    SmaI TCCCCCGGGGGA >90 >90
    SpeI GACTAGTC 10 >90
    SphI ACATGCATGCATGT 10 50
    StuI AAGGCCTT >90 >90
    XbaI GCTCTAGAGC >90 >90
    XhoI CCGCTCGAGCGG 10 75
    XmaI TCCCCCCGGGGGGA >90 >90

     aReprinted with permission from New England Biolabs.

Basic Protocol 2: Introduction of Point Mutations by PCR

  Materials
  • DNA sample to be mutagenized
  • Klenow fragment of E. coli DNA polymerase I (unit 3.5)
  • Appropriate restriction endonuclease (Table 8.5.1)
  • Additional reagents and equipment for synthesis and purification of oligonucleotides (units 2.11 & 2.12), phosphorylation of oligonucleotides (unit 3.10), electrophoresis of DNA on nondenaturing agarose and low gelling/melting agarose gels (units 2.5 & 2.6), restriction endonuclease digestion (unit 3.1), ligation of DNA fragments (unit 3.16), transformation of E. coli (unit 1.8), plasmid DNA miniprep (unit 1.6), and DNA sequence analysis (unit 7.4)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 8.5.1 Introduction of a restriction site into a specific DNA fragment. (A) The fragment of interest is cloned into a high‐copy‐number vector. Sites for two oligonucleotide primers, such as the M13 forward and reverse primers (F and R), flank the cloning site. In two separate reactions, fragments upstream (A—E) and downstream (E—C) of the introduced site are PCR‐amplified using the flanking primers and oligonucleotides containing the site to be introduced (primers F and 1, R and 2). The amplified fragments are digested with the appropriate restriction endonucleases, then ligated and subcloned into an appropriately cut vector and transformed into E. coli. The resultant plasmid contains an inserted fragment identical to the original DNA except for the introduced restriction site. (B) The oligonucleotides needed to change the primary sequence to an EcoRI restriction site are indicated. Note the four‐base “clamp” sequence at the 5′ end of the primers.
  •   FigureFigure 8.5.2 Introduction of a point mutation into a specific DNA fragment. (A) The fragment of interest is cloned into a high‐copy‐number plasmid vector. Sites for two oligonucleotide primers, such as the M13 forward and reverse primers (F and R), flank the cloning site. In two separate reactions, fragments upstream (A—M) and downstream (M—C) of the point mutation are PCR‐amplified using the flanking primers and oligonucleotides containing the point mutation to be introduced (primers F and 3, R and 4). The fragments are digested with the appropriate restriction endonucleases and made blunt‐ended. These fragments are ligated and subcloned into an appropriately cut vector and transformed into E. coli. The resultant plasmid contains an inserted fragment identical to the original DNA except for the introduced point mutation. (B) The oligonucleotides needed to generate a point mutation in the primary sequence are shown. Note that there are no “clamp” sequences at the 5′ ends of the primers.
  •   FigureFigure 8.5.3 Introduction of a point mutation by sequential PCR steps. (A) The first steps of this protocol are as described in Figure A except primers 5 and 6 are used. The amplified fragments are then placed in the same tube and amplified in a second PCR step (using primers F and R only). This second PCR step obviates the need for the blunt‐end ligation. The full‐length fragment generated here is digested with the appropriate restriction endonucleases, subcloned into an appropriately cut vector, and transformed into E. coli. The resultant plasmid contains an inserted fragment identical to the original DNA except for the point mutation. (B) The oligonucleotide primers needed to generate a point mutation in this procedure are shown. Note that there are 12 bases of overlap between the two primers.

Videos

Literature Cited

Literature Cited
   Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., and Erlich, H.A. 1988. Primer‐directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487‐491.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library