Determination of Protein‐DNA Sequence Specificity by PCR‐Assisted Binding‐Site Selection

Roy M. Pollock1

1 Ariad Pharmaceuticals, Inc., Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 12.11
DOI:  10.1002/0471142727.mb1211s33
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Binding‐site selection is used to determine the target specificity of a sequence‐specific DNA‐binding protein. In this unit, a pool of random‐sequence oligonucleotides is used as the source of potential binding sites. This pool is incubated with extract containing the DNA‐binding protein of interest and the protein‐DNA complexes are isolated by immunoprecipitation with an antibody specific for the protein under investigation. Unbound oligonucleotides are removed by gentle washing, and bound oligonucleotides are recovered, amplified by the polymerase chain reaction (PCR), and used as input DNA for a further round of binding, recovery, and amplification. After four rounds of selection, progress of the procedure is monitored by mobility shift analysis of the selected oligonucleotide pools. In the , individual binding sites are isolated from the appropriate complex on a mobility shift gel, cloned into plasmids, and examined by sequencing.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Support Protocol 1: Isolation and Analysis of Bound Oligonucleotides from Mobility Shift Gels
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Random‐sequence oligonucleotide R76:
  • 5′‐CAGGTCAGTTCAGCGGATCCTGTCG(A/G/C/T) 26GAGGCGAATTCAGTGCAACTGCAGC‐3′ (see unit 2.11)
  • Primer F: 5′‐GCTGCAGTTGCACTGAATTCGCCTC‐3′
  • Primer R: 5′‐CAGGTCAGTTCAGCGGATCCTGTCG‐3′
  • 10× Taq DNA polymerase buffer (unit 3.4)
  • 0.5 mM 3dNTP mix (minus dCTP; unit 3.4)
  • 40 µM and 0.5 mM dCTP (unit 3.4)
  • 10 mCi/ml [α‐32P]dCTP (800 Ci/mmol)
  • 5 U/µl Taq DNA polymerase (unit 3.5)
  • recipeElution buffer (see recipe)
  • Glycogen carrier (e.g., Boehringer Mannheim)
  • TE buffer, pH 7.5 to 8.0 ( appendix 22)
  • Protein A–Sepharose CL‐4B (Pharmacia Biotech)
  • recipeWash buffer (see recipe), with and without 50 µg/ml BSA
  • recipeBinding buffer (see recipe), with and without 50 µg/ml BSA
  • Carrier DNA: e.g., 100 ng/µl poly(dI‐dC)⋅poly(dI‐dC)
  • Protein sample: reticulocyte lysate or nuclear extract containing DNA‐binding protein of interest, or purified DNA‐binding protein (if available)
  • Antiserum to protein of interest, or (if protein is epitope‐tagged and monoclonal antibody is available) appropriate ascites fluid
  • recipeRecovery buffer (see recipe)
  • 2.5 M sodium acetate
  • 5 M ammonium acetate
  • Scintillation vials and counter
  • 17 × 100–mm polystyrene centrifuge tube with snap‐cap
  • Tumbler or rotating wheel
  • Whatman 3MM paper
  • Additional reagents and equipment for purification of oligonucleotides using denaturing (unit 2.12) and nondenaturing PAGE (unit 2.7), autoradiography ( appendix 3A), phenol/chloroform extraction and ethanol precipitation (unit 2.1), and mobility shift DNA‐binding assay (unit 12.2)

Support Protocol 1: Isolation and Analysis of Bound Oligonucleotides from Mobility Shift Gels

  • EcoRI and BamHI restriction endonucleases and appropriate buffer (unit 3.1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Blackwell, T.K. and Weintraub, H. 1990. Differences and similarities in DNA‐binding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science 250:1104‐1110.
   Chittenden, T., Livingston, D.M., and Kaelin, W.J. 1991. The T/E1A‐binding domain of the retinoblastoma product can interact selectively with a sequence‐specific DNA‐binding protein. Cell 65:1073‐1082.
   Ekker, S.C., Young, K.E., von, K.D., and Beachy, P.A. 1991. Optimal DNA sequence recognition by the Ultrabithorax homeodomain of Drosophila. EMBO J. 10:1179‐1186.
   Funk, W.D. and Wright, W.E. 1992. Cyclic amplification and selection of targets for multicomponent complexes: Myogenin interacts with factors recognizing binding sites for basic helix‐loop‐helix, nuclear factor 1, myocyte‐specific enhancer‐binding factor 2, and COMP1 factor. Proc. Natl. Acad. Sci. U.S.A. 89:9484‐9488.
   Kinzler, K.W. and Vogelstein, B. 1989. Whole genome PCR: Application to the identification of sequences bound by gene regulatory proteins. Nucl. Acids Res. 17:3645‐3653.
   Oliphant, A.R., Brandl, C.J., and Struhl, K. 1989. Defining the sequence specificity of DNA‐binding proteins by selecting binding sites from random‐sequence oligonucleotides: Analysis of yeast GCN4 protein. Mol. Cell Biol. 9:2944‐2949.
   Pollock, R. and Treisman, R. 1990. A sensitive method for the determination of protein‐DNA‐binding specificities. Nucl. Acids Res. 18:6197‐6204.
   Thiesen, H.J. and Bach, C. 1990. Target Detection Assay (TDA): A versatile procedure to determine DNA binding sites as demonstrated on SP1 protein. Nucl. Acids Res. 18:3203‐3209.
Key References
   Pollock, R. and Treisman, R. 1990. A sensitive method for the determination of protein‐DNA‐binding specificities. Nucl. Acids Res. 18:6197‐6204.
  Describes the use of the method upon which this protocol is based to select binding sites for SRF and FOS protein present in nuclear or in vitro translation extracts. Also demonstrates the use of epitope tagging to recover protein‐DNA complexes.
   Szostak, J.W. 1992. In vitro genetics. Trends Biochem. Sci. 17:89‐93.
  Contains a useful review of site selection techniques.
   Wright, W.E. and Funk, W.D. 1993. CASTing for multicomponent DNA‐binding complexes. Trends Biochem. Sci. 18:77‐80.
  A review of immunoprecipitation of protein‐DNA complexes from nuclear extracts and its application in selecting sites for interacting transcription factors within multicomponent complexes.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library