Engineering Designer Nucleases with Customized Cleavage Specificities

Jeffry D. Sander1, Morgan L. Maeder2, J. Keith Joung2

1 Department of Pathology, Harvard Medical School, Boston, Massachusetts, 2 Biological and Biomedical Sciences Program, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 12.13
DOI:  10.1002/0471142727.mb1213s96
Online Posting Date:  October, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Engineered designer nucleases can be used to efficiently modify genomic sequence in a wide variety of model organisms and cell types. Zinc finger nucleases (ZFNs), consisting of an engineered zinc finger array fused to a non‐specific cleavage domain, have been extensively used to modify a broad range of endogenous genes. Protocols for engineering ZFNs targeted to specific gene sequences of interest using the context‐dependent assembly (CoDA) method are described in this unit. Curr. Protoc. Mol. Biol. 96:12.13.1‐12.13.16. © 2011 by John Wiley & Sons, Inc.

Keywords: zinc finger nucleases; zinc finger proteins; context‐dependent assembly; protein engineering; DNA‐binding domains

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Identifying CoDA ZFN Targets and Synthesizing CoDA ZFN‐Encoding DNA
  • Support Protocol 1: Bacterial Two‐Hybrid (B2H) Assay to Quantify DNA‐Binding Activities of Zinc Finger Arrays
  • Basic Protocol 2: Construction of ZFN Expression Vectors
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identifying CoDA ZFN Targets and Synthesizing CoDA ZFN‐Encoding DNA

  Materials
  • DNA sequence of genomic region to target with ZFNs
  • Computer with internet access

Support Protocol 1: Bacterial Two‐Hybrid (B2H) Assay to Quantify DNA‐Binding Activities of Zinc Finger Arrays

  Materials
  • pGP‐FF plasmid (plasmid, restriction map, and full sequence available from Addgene; http://www.addgene.org/zfc)
  • XbaI restriction enzyme (NEB)
  • BamHI‐HF restriction enzyme (NEB)
  • QIAquick gel extraction kit (Qiagen)
  • Synthesized zinc finger plasmid (see protocol 1)
  • Quick ligation kit (NEB)
  • Chemically competent XL1‐Blue cells (Stratagene)
  • LB broth (Difco, cat. no. 244620)
  • LB agar plates (Difco, cat. no. 244520) supplemented with 100 µg/ml carbenicillin
  • Carbenicillin (Sigma, cat. no. T4625)
  • QIAprep spin miniprep kit (Qiagen)
  • Primer OK61: 5′‐GGGTAGTACGATGACGGAACCTGTC‐3′
  • pBAC‐LacZ plasmid (plasmid, restriction map, and full DNA sequence available from Addgene; http://www.addgene.org/zfc)
  • BsaI restriction enzyme (NEB)
  • Nuclease‐free water
  • Cloned Pfu polymerase and 10× reaction buffer (Stratagene)
  • dCTP nucleotide
  • 10× annealing buffer (see recipe)
  • Chemically competent bacterial strain (Transformax Epi300, Epicentre)
  • Chloramphenicol
  • Arabinose
  • Chemically competent bacterial strain KJBAC1 (Addgene)
  • Primer OK5: 5′‐AAAATAGGCGTATCACGAGGCCCT‐3′
  • Primer OK163: 5′‐CGCCAGGGTTTTCCCAGTCACGAC‐3′
  • Expand high‐fidelity PCR kit (Roche Applied Science)
  • 1 M MgCl 2 ( appendix 22)
  • Solution A with glycerol (see recipe)
  • pAC‐Kan‐alpha‐Gal4 plasmid (Addgene)
  • LB agar plates (unit 1.1) supplemented with 100 µg/ml carbenicillin, 12.5 µg/ml chloramphenicol, and 30 µg/ml kanamycin
  • Kanamycin
  • 10 mM ZnSO 4
  • 500 mM IPTG
  • Lysis master mix (see recipe)
  • Z‐buffer with β‐mercaptoethanol (see recipe)
  • 4 mg/ml ONPG
  • 200‐µl and 1.5‐ml microcentrifuge tubes
  • 37°C, 42°C, 50°C, and 72°C water baths
  • 37°C incubator with shaking
  • 95°C heating block
  • 50‐ml conical tubes, sterile
  • 96‐well microtiter plates
  • 2‐ml assay blocks (Corning)
  • Microtiter plate reader with temperature control option (e.g., Biorad model 680)
  • Additional reagents and equipment for PCR (unit 15.1), gel purification (unit 2.5 or )

Basic Protocol 2: Construction of ZFN Expression Vectors

  Materials
  • Nuclease expression plasmids (see Table 12.13.2):
    • pST1374, MLM290 and MLM292, or MLM800 and MLM802
  • Synthesized zinc finger constructs (see protocol 1)
  • XbaI (NEB)
  • BamHI (NEB)
  • NotI (NEB)
  • QIAquick gel extraction kit (Qiagen)
  • Nuclease‐free water
  • Quick ligation kit (NEB)
  • Chemically competent bacterial strain XL‐1 Blue (recA1 endA1 gyrA96 thi‐1 hsdR17 supE44 relA1 lac [F' proAB lacIq lacZDM15 Tn10 (TetR)]; Stratagene, cat. no. 200249)
  • LB medium (Difco, cat. no. 244620)
  • LB agar (Difco, cat. no. 244520) plates supplemented with 100 µg/ml carbenicillin
  • Carbenicillin (Sigma, cat. no T4625; 50 mg/ml–1 stock solution in water)
  • QIAprep spin miniprep kit (Qiagen)
  • Primer OK567: 5′‐CGCAAATGGGCGGTAGGCGTG‐3′
  • 37°C water bath
  • 37°C shaking incubator
  • Additional reagents and equipment for gel isolation (unit 2.6)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Beerli, R.R. and Barbas, C.F. 3rd. 2002. Engineering polydactyl zinc‐finger transcription factors. Nat. Biotechnol. 20:135‐141.
   Bibikova, M., Golic, M., Golic, K.G., and Carroll, D. 2002. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc‐finger nucleases. Genetics 161:1169‐1175.
   Bibikova, M., Beumer, K., Trautman, J.K., and Carroll, D. 2003. Enhancing gene targeting with designed zinc finger nucleases. Science 300:764.
   Carroll, D., Morton, J.J., Beumer, K.J., and Segal, D.J. 2006. Design, construction and in vitro testing of zinc finger nucleases. Nat. Protoc. 1:1329‐1341.
   Cornu, T.I., Thibodeau‐Beganny, S., Guhl, E., Alwin, S., Eichtinger, M., Joung, J., and Cathomen, T. 2008. DNA‐binding specificity is a major determinant of the activity and toxicity of zinc‐finger nucleases. Mol. Ther. 16:352‐358.
   Curtin, S.J., Zhang, F., Sander, J.D., Haun, W.J., Starker, C., Baltes, N.J., Reyon, D., Dahlborg, E.J., Goodwin, M.J., Coffman, A.P., Dobbs, D., Joung, J.K., Voytas, D.F., and Stupar, R.M. 2011. Targeted mutagenesis of duplicated genes in soybean with zinc‐finger nucleases breakthrough technologies. Plant Physiol. 156:466‐473.
   Foley, J.E., Yeh, J.‐R.J., Maeder, M.L., Reyon, D., Sander, J.D., Peterson, R.T., and Joung, J.K. 2009. Rapid mutation of endogenous zebrafish genes using zinc finger nucleases made by oligomerized pool engineering. PLoS ONE 4:e4348.
   Gonzalez, B., Schwimmer, L.J., Fuller, R.P., Ye, Y., Asawapornmongkol, L., and Barbas, C.F. 3rd. 2010. Modular system for the construction of zinc‐finger libraries and proteins. Nat. Protoc. 5:791‐810.
   Handel, E.M., Alwin, S., and Cathomen, T. 2009. Expanding or restricting the target site repertoire of zinc‐finger nucleases: The inter‐domain linker as a major determinant of target site selectivity. Mol. Ther. 17:104‐111.
   Hurt, J.A., Thibodeau, S.A., Hirsh, A.S., Pabo, C.O., and Joung, J.K. 2003. Highly specific zinc finger proteins obtained by directed domain shuffling and cell‐based selection. Proc. Natl. Acad. Sci. U.S.A. 100:12271‐12276.
   Kim, H.J., Lee, H.J., Kim, H., Cho, S.W., and Kim, J.S. 2009. Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res. 19:1279‐1288.
   Kim, Y.G., Cha, J., and Chandrasegaran, S. 1996. Hybrid restriction enzymes: Zinc finger fusions to FokI cleavage domain. Proc. Natl. Acad. Sci. U.S.A. 93:1156‐1160.
   Maeder, M.L., Thibodeau‐Beganny, S., Osiak, A., Wright, D.A., Anthony, R.M., Eichtinger, M., Jiang, T., Foley, J.E., Winfrey, R.J., Townsend, J.A., Unger‐Wallace, E., Sander, J.D., Müller‐Lerch, F., Fu, F., Pearlberg, J., Göbel, C., Dassie, J.P., Pruett‐Miller, S.M., Porteus, M.H., Sgroi, D.C., Iafrate, A.J., Dobbs, D., McCray, P.B. Jr., Cathomen, T., Voytas, D.F., and Joung, J.K. 2008. Rapid “open‐source” engineering of customized zinc‐finger nucleases for highly efficient gene modification. Mol. Cell 31:294‐301.
   Maeder, M.L., Thibodeau‐Beganny, S., Sander, J.D., Voytas, D.F., and Joung, J.K. 2009. Oligomerized pool engineering (OPEN): An ‘open‐source’ protocol for making customized zinc‐finger arrays. Nat. Protoc. 4:1471‐1501.
   Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., Gregory, P.D., Pabo, C.O., and Rebar, E.J. 2007. An improved zinc‐finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25:778‐785.
   Rahman, S.H., Maeder, M.L., Joung, J.K., and Cathomen, T. 2011. Zinc‐finger nucleases for somatic gene therapy: The next frontier. Hum. Gene Ther. 22:1‐10.
   Ramirez, C.L., Foley, J.E., Wright, D.A., Muller‐Lerch, F., Rahman, S.H., Cornu, T.I., Winfrey, R.J., Sander, J.D., Fu, F., Townsend, J.A., Cathomen, T., Voytas, D.F., and Joung, J.K. 2008. Unexpected failure rates for modular assembly of engineered zinc‐fingers. Nat. Methods 5:374‐375.
   Sander, J.D., Dahlborg, E.J., Goodwin, M.J., Cade, L., Zhang, F., Cifuentes, D., Curtin, S.J., Blackburn, J.S., Thibodeau‐Beganny, S., Qi, Y., Pierick, C.J., Hoffman, E., Maeder, M.L., Khayter, C., Reyon, D., Dobbs, D., Langenau, D.M., Stupar, R.M., Giraldez, A.J., Voytas, D.F., Peterson, R.T., Yeh, J.R., and Joung, J.K. 2011. Selection‐free zinc‐finger‐nuclease engineering by context‐dependent assembly (CoDA). Nat. Methods 8:67‐69.
   Santiago, Y., Chan, E., Liu, P.Q., Orlando, S., Zhang, L., Urnov, F.D., Holmes, M.C., Guschin, D., Waite, A., Miller, J.C., Rebar, E.J., Gregory, P.D., Klug, A., and Collingwood, T.N. 2008. Targeted gene knockout in mammalian cells by using engineered zinc‐finger nucleases. Proc. Natl. Acad. Sci. U.S.A. 105:5809‐5814.
   Townsend, J.A., Wright, D.A., Winfrey, R.J., Fu, F., Maeder, M.L., Joung, J.K., and Voytas, D.F. 2009. High‐frequency modification of plant genes using engineered zinc‐finger nucleases. Nature 459:442‐445.
   Urnov, F.D., Miller, J.C., Lee, Y.L., Beausejour, C.M., Rock, J.M., Augustus, S., Jamieson, A.C., Porteus, M.H., Gregory, P.D., and Holmes, M.C. 2005. Highly efficient endogenous human gene correction using designed zinc‐finger nucleases. Nature 435:646‐651.
   Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. 2010. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11:636‐646.
   Wright, D.A., Thibodeau‐Beganny, S., Sander, J.D., Winfrey, R.J., Hirsh, A.S., Eichtinger, M., Fu, F., Porteus, M.H., Dobbs, D., Voytas, D.F., and Joung, J.K. 2006. Standardized reagents and protocols for engineering zinc finger nucleases by modular assembly. Nat. Protoc. 1:1637‐1652.
   Zhang, F., Maeder, M.L., Unger‐Wallace, E., Hoshaw, J.P., Reyon, D., Christian, M., Li, X., Pierick, C.J., Dobbs, D., Peterson, T., Joung, J.K., and Voytas, D.F. 2010. High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. Proc. Natl. Acad. Sci. U.S.A. 107:12028‐12033.
   Zou, J., Maeder, M.L., Mali, P., Pruett‐Miller, S.M., Thibodeau‐Beganny, S., Chou, B.K., Chen, G., Ye, Z., Park, I.H., Daley, G.Q., Porteus, M.H., Joung, J.K., and Cheng, L. 2009. Gene targeting of a disease‐related gene in human induced pluripotent stem and embryonic stem cells. Cell Stem Cell 5:97‐110.
Key References
  Sander et al., 2011. See above.
  Describes the CoDA method and demonstrates the efficacy of ZFNs produced by this approach in plants and zebrafish.
Internet Resources
  http://zifit.partners.org
  Provides access to the ZiFiT software program for engineering zinc fingers using CoDA.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library