Engineering Designer Transcription Activator‐‐Like Effector Nucleases (TALENs) by REAL or REAL‐Fast Assembly

Deepak Reyon1, Cyd Khayter2, Maureen R. Regan2, J. Keith Joung1, Jeffry D. Sander1

1 Department of Pathology, Harvard Medical School, Boston, Massachusetts, 2 Molecular Pathology Unit, Center for Computational and Integrative Biology and Center for Cancer Research, Massachusetts General Hospital, Charlestown, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 12.15
DOI:  10.1002/0471142727.mb1215s100
Online Posting Date:  October, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Engineered transcription activator–like effector nucleases (TALENs) are broadly useful tools for performing targeted genome editing in a wide variety of organisms and cell types including plants, zebrafish, C. elegans, rat, human somatic cells, and human pluripotent stem cells. Here we describe detailed protocols for the serial, hierarchical assembly of TALENs that require neither PCR nor specialized multi‐fragment ligations and that can be implemented by any laboratory. These restriction enzyme and ligation (REAL)–based protocols can be practiced using plasmid libraries and user‐friendly, Web‐based software that both identifies target sites in sequences of interest and generates printable graphical guides that facilitate assembly of TALENs. With the described platform of reagents, protocols, and software, researchers can easily engineer multiple TALENs within 2 weeks using standard cloning techniques. Curr. Protoc. Mol. Biol. 100:12.15.1‐12.15.14. © 2012 by John Wiley & Sons, Inc.

Keywords: TALEN; TALENs; engineered TAL effector nucleases; engineered TALE nucleases; REAL; REAL‐Fast; protein engineering; DNA‐binding domains; FLASH

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Engineering Customized TALENs
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Engineering Customized TALENs

  Materials
  • Genomic sequence of interest
  • Plasmids encoding individual TALE repeats (available through Addgene, http://www.addgene.org/talengineering)
  • Restriction enzymes from New England Biolabs:
    • BamHI (cat. no. R0136S)
    • BbsI (cat. no. R0539L)
    • BsaI (cat, no. R0535L)
    • BsmBI (cat. no. R0580L)
    • KpnI‐HF (cat. no. R3142L)
  • 10× restriction enzyme buffers included with enzymes from New England Biolabs:
    • NEBuffer 2
    • NEBuffer 3
    • NEBuffer 4
  • 10 µg/ml bovine serum albumin (included with enzymes from New England Biolabs)
  • Nuclease‐free H 2O (unit 4.1)
  • 5% nondenaturing polyacrylamide gel (unit 2.7)
  • Quick Ligation Kit (New England Biolabs, cat. No. M2200L)
  • Chemically competent bacterial strain XL‐1 Blue (recA1 endA1 gyrA96 thi‐1 hsdR17 supE44 relA1 lac [F' proAB lacIq lacZDM15 Tn 10 (TetR)]; Stratagene, cat no. 200249)
  • LB liquid medium and agar plates (unit 1.1). with and without 100 µg/ml carbenicillin (Sigma, cat. no C1389)
  • TALEN Expression Vectors (available through Addgene: http://www.addgene.org/talengineering)
  • Archive of preassembled TALE arrays for practicing REAL‐Fast (available through the Joung lab; see http://www.TALengineering.org)
  • Sequencing primers (optional):
    • Sequencing primer OK163: 5′ CGCCAGGGTTTTCCCAGTCACGAC 3′
    • Sequencing primer JDS2978: 5′ TTGAGGCGCTGCTGACTG 3′
    • Sequencing primer JDS2980: 5′ TTAATTCAATATATTCATGAGGCAC 3′
    • Sequencing primer JDS2778: 5′ CTGGCGCAATGCGCTCAC 3′
    • Sequencing primer JDS2979: 5′ AAGCAATGGCGACCACCTGTTC 3′
  • 42°C water bath
  • Sterile bacterial culture tubes
  • Orbital platform shaker with adjustable speed
  • Additional reagents and equipment for nondenaturing polyacrylamide gel electrophoresis (unit 2.7) and transformation of bacteria (unit 1.8)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Baker, M. 2012. Gene‐editing nucleases. Nat. Methods 9:23–26.
   Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. 2009. Breaking the code of DNA binding specificity of TAL‐type III effectors. Science 326:1509‐1512.
   Bogdanove, A.J., Schornack, S., and Lahaye, T. 2010. TAL effectors: Finding plant genes for disease and defense. Curr. Opin. Plant Biol. 13:394‐401.
   Bogdanove, A.J. and Voytas, D.F. 2011. TAL effectors: Customizable proteins for DNA targeting. Science 333:1843‐1846.
   Briggs, A.W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., and Church, G.M. 2012. Iterative capped assembly: rapid and scalable synthesis of repeat‐module DNA such as TAL effectors from individual monomers. Nucleic Acids Res. 2012 Jun 26. [Epub ahead of print]
   Cade, L., Reyon, D., Hwang, W.Y., Tsai, S.Q., Patel, S., Khayter, C., Joung, J.K., Sander, J.D., Peterson, R.T., and Yeh, J.R. 2012. Highly efficient generation of heritable zebrafish gene mutations using homo‐ and heterodimeric TALENs. Nucleic Acids Res. 2012 Jun 7. [Epub ahead of print]
   Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. 2011. Efficient design and assembly of custom TALEN and other TAL effector‐based constructs for DNA targeting. Nucleic Acids Res. 39:e82.
   Christian, M., Cermak, T., Doyle, E.L., Schmidt, C., Zhang, F., Hummel, A., Bogdanove, A.J., and Voytas, D.F. 2010. Targeting DNA double‐strand breaks with TAL effector nucleases. Genetics 186:757‐761.
   DeFrancesco, L. 2011. Move over ZFNs. Nat. Biotechnol. 29:681‐684.
   Foley, J.E., Maeder, M.L., Pearlberg, J., Joung, J.K., Peterson, R.T., and Yeh, J.R. 2009. Targeted mutagenesis in zebrafish using customized zinc‐finger nucleases. Nat. Protoc. 4:1855‐1867.
   Geissler, R., Scholze, H., Hahn, S., Streubel, J., Bonas, U., Behrens, S.E., and Boch, J. 2011. Transcriptional activators of human genes with programmable DNA‐specificity. PLoS ONE 6:e19509.
   Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Jaenisch, R. 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29:731‐734.
   Huang, P., Xiao, A., Zhou, M., Zhu, Z., Lin, S., and Zhang, B. 2011. Heritable gene targeting in zebrafish using customized TALENs. Nat. Biotechnol. 29:699‐700.
   Li, T., Huang, S., Jiang, W.Z., Wright, D., Spalding, M.H., Weeks, D.P., and Yang, B. 2011a. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA‐cleavage domain. Nucleic Acids Res. 39:359‐372.
   Li, T., Huang, S., Zhao, X., Wright, D.A., Carpenter, S., Spalding, M.H., Weeks, D.P., and Yang, B. 2011b. Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic Acids Res. 39:6315‐6325.
   Li, L., Piatek, M.J., Atef, A., Piatek, P., Wibowo, A., Fang, X., Sabir, J.S.M., Zhu, J., and Mahfouz, M.M. 2012. Rapid and highly efficient construction of TALE‐based transcriptional regulators and nucleases for genome modification. Plant Mol. Biol. 78:407‐416.
   Maeder, M.L., Thibodeau‐Beganny, S., Osiak, A., Wright, D.A., Anthony, R.M., Eichtinger, M., Jiang, T., Foley, J.E., Winfrey, R.J., Townsend, J.A., Unger‐Wallace, E., Sander, J.D., Müller‐Lerch, F., Fu, F., Pearlberg, J., Göbel, C., Dassie, J.P., Pruett‐Miller, S.M., Porteus, M.H., Sgroi, D.C., Iafrate, A.J., Dobbs, D., McCray, P.B. Jr., Cathomen, T., Voytas, D.F., and Joung, J.K. 2008. Rapid “open‐source” engineering of customized zinc‐finger nucleases for highly efficient gene modification. Mol. Cell 31:294‐301.
   Mahfouz, M.M., Li, L., Shamimuzzaman, M., Wibowo, A., Fang, X., and Zhu, J.K. 2011. De novo‐engineered transcription activator‐like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double‐strand breaks. Proc. Natl. Acad. Sci. U.S.A. 108:2623‐2628.
   Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., and Rebar, E.J. 2011. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29:143‐148.
   Moore, F.E., Reyon, D., Sander, J.D., Martinez, S.A., Blackburn, J.S., Khayter, C., Ramirez, C.L., Joung, J.K., and Langenau, D.M. 2012. Improved somatic mutagenesis in zebrafish using transcription activator‐like effector nucleases (TALENs). PLoS One 7:e37877
   Morbitzer, R., Elsaesser, J., Hausner, J., and Lahaye, T. 2011. Assembly of custom TALE‐type DNA binding domains by modular cloning. Nucleic Acids Res. 39:5790‐5799.
   Moscou, M.J. and Bogdanove, A.J. 2009. A simple cipher governs DNA recognition by TAL effectors. Science 326:1501.
   Mussolino, C., Morbitzer, R., Lutge, F., Dannemann, N., Lahaye, T., and Cathomen, T. 2011. A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res. 39:9283‐9293.
   Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D., and Joung, J.K. 2012. FLASH assembly of TALENs for high‐throughput genome editing. Nat. Biotechnol. 30:460‐465.
   Sander, J.D., Cade, L., Khayter, C., Reyon, D., Peterson, R.T., Joung, J.K., and Yeh, J.R. 2011. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat. Biotechnol. 29:697‐698.
   Scholze, H. and Boch, J. 2011. TAL effectors are remote controls for gene activation. Curr. Opin. Microbiol. 14:47‐53
   Streubel, J., Blücher, C., Landgraf, A., and Boch, J. 2012. TAL effector RVD specificities and efficiencies Nat. Biotechnol. 30:593‐595.
   Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y., Vincent, A.I., Meng, X., Zhang, L., Gregory, P.D., Anegon, I., and Cost, G.J. 2011. Knockout rats generated by embryo microinjection of TALENs. Nat. Biotechnol. 29:695‐696.
   Wang, Z., Li, J., Huang, H., Wang, G., Jiang, M., Yin, S., Sun, C., Zhang, H., Zhuang, F., and Xi, J.J. 2012. An integrated chip for the high‐throughput synthesis of transcription activator‐like effectors Angew. Chem. Int. Ed. Engl. 51:1‐5.
   Weber, E., Gruetzner, R., Werner, S., Engler, C., and Marillonnet, S. 2011. Assembly of designer TAL effectors by Golden Gate cloning. PLoS ONE 6:e19722.
   Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Meyer, B.J. 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333:307.
   Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., and Arlotta, P. 2011. Efficient construction of sequence‐specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol. 29:149‐153.
Key References
   Sander et al., 2011. See above.
  Describes the plasmids required to practice REAL and the efficacy of TALENs produced by this architecture in zebrafish.
   Reyon et al., 2012. See above.
  Describes archive of plasmids encoding pre‐assembled TALE repeat arrays that is required to practice REAL‐Fast and demonstrates that TALENs constructed on the same architecture as those made by REAL and REAL‐Fast function robustly and have high rate of success in human cells.
Internet Resources
  http://zifit.partners.org
  Provides access to the ZiFiT Targeter software program for engineering TALENs.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library