Engineering Customized TALE Nucleases (TALENs) and TALE Transcription Factors by Fast Ligation‐Based Automatable Solid‐Phase High‐Throughput (FLASH) Assembly

Deepak Reyon1, Morgan L. Maeder2, Cyd Khayter3, Shengdar Q. Tsai1, Jonathan E. Foley3, Jeffry D. Sander1, J. Keith Joung2

1 Department of Pathology, Harvard Medical School, Boston, Massachusetts, 2 Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, Massachusetts, 3 Molecular Pathology Unit, Center for Computational and Integrative Biology, and Center for Cancer Research, Massachusetts General Hospital, Charlestown, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 12.16
DOI:  10.1002/0471142727.mb1216s103
Online Posting Date:  July, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Customized DNA‐binding domains made using transcription activator‐like effector (TALE) repeats are rapidly growing in importance as widely applicable research tools. TALE nucleases (TALENs), composed of an engineered array of TALE repeats fused to the FokI nuclease domain, have been used successfully for directed genome editing in various organisms and cell types. TALE transcription factors (TALE‐TFs), consisting of engineered TALE repeat arrays linked to a transcriptional regulatory domain, have been used to up‐ or downregulate expression of endogenous genes in human cells and plants. This unit describes a detailed protocol for the recently described fast ligation‐based automatable solid‐phase high‐throughput (FLASH) assembly method. FLASH enables automated high‐throughput construction of engineered TALE repeats using an automated liquid handling robot or manually using a multichannel pipet. Using the automated approach, a single researcher can construct up to 96 DNA fragments encoding TALE repeat arrays of various lengths in a single day, and then clone these to construct sequence‐verified TALEN or TALE‐TF expression plasmids in a week or less. Plasmids required for FLASH are available by request from the Joung lab (http://eGenome.org). This unit also describes improvements to the Zinc Finger and TALE Targeter (ZiFiT Targeter) web server (http://ZiFiT.partners.org) that facilitate the design and construction of FLASH TALE repeat arrays in high throughput. Curr. Protoc. Mol. Biol. 103:12.16.1–12.16.18. © 2013 by John Wiley & Sons, Inc.

Keywords: FLASH; TALEN; TALE; TAL effector; TALE activator

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Identification of Target Sites Using ZiFiT Targeter Software
  • Basic Protocol 2: Flash Assembly of DNA Encoding TALE Repeat Arrays
  • Support Protocol 1: Preparation of the α Unit
  • Support Protocol 2: Preparation of Extension and Termination Units
  • Basic Protocol 3: Cloning and Sequence Verification of TALEN or TALE‐TF Expression Vectors
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identification of Target Sites Using ZiFiT Targeter Software

  Materials
  • ZiFiT web‐based software (http://ZiFiT.partners.org)
  • Repeat Masker web‐based software (http://www.repeatmasker.org)
  • Genomic sequence of locus to be targeted
  • Computer with internet browser and internet connection

Basic Protocol 2: Flash Assembly of DNA Encoding TALE Repeat Arrays

  Materials
  • Digested FLASH reagents:
    • α unit (see protocol 3)
    • Extension unit (encoding two or four repeats; see protocol 4)
    • Termination unit (encoding one, two, or three TALE repeats; see protocol 4)
  • 2× quick ligation buffer (QLB; see recipe)
  • T4 DNA ligase (New England Biolabs, cat. no. M0202L)
  • 20 U/µl BsaI‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3535L)
  • 5 U/µl BbsI with 10× NEBuffer 2 (New England Biolabs, cat. no. R0539L)
  • DEPC‐treated water (see recipe)
  • Phosphorylated capping oligo (see recipe)
  • 2× B&W buffer (see recipe)
  • 1× bovine serum albumin (BSA): dilute 100× stock (10 mg/ml, New England Biolabs, cat. no. B9001S) in nuclease‐free DEPC‐treated water
  • SciClone G3 (Caliper) or comparable liquid handling system (for high throughput) or multichannel pipet (12‐channel, 20‐200 and 10‐100 µl; for medium throughput)
  • 96‐well PCR plates
  • 96‐well StrepMax streptavidin‐coated plates (Thermo Scientific, cat. no. AB‐1226)
  • Thermocycler
  • Orbital platform shaker with adjustable speed
  • MinElute PCR Purification Kit (Qiagen cat. no. 28006)
  • 1.5‐ml microcentrifuge tubes

Support Protocol 1: Preparation of the α Unit

  Materials
  • 10 mM dNTPs (Roche, cat. no. 11969064001)
  • Plasmids encoding α units (available from Joung lab, http://eGenome.org)
  • Expand High‐Fidelity PCR System (Roche, cat. no. 11732641001)
  • 10 pmol/µl biotinylated forward PCR primer oJS2581: 5′‐biotin‐TCTAGAGAAGACAAGAACCTGACC‐3′
  • 10 pmol/µl reverse PCR primer oJS2582: 5′‐GGATCCGGTCTCTTAAGGCCGTGG‐3′
  • DEPC‐treated water (see recipe)
  • 20 U/µl BsaI‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3535L)
  • 1.5‐ml PCR tubes
  • Thermocycler
  • QIAquick PCR Purification Kit (Qiagen, cat. no. 28106)
  • Additional reagents and equipment for quantifying microvolumes of DNA ( appendix 3D or )

Support Protocol 2: Preparation of Extension and Termination Units

  Materials
  • Plasmids encoding extension and termination units (available from Joung lab, http://eGenome.org)
  • BbsI with 10× NEBuffer 2 (New England Biolabs, cat. no. R0539L)
  • BamHI‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3136L)
  • XbaI with 10× NEBuffer 4 (New England Biolabs, cat. no. R0145L)
  • SalI‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3138L)
  • DEPC‐treated water (see recipe)
  • 100× bovine serum albumin (BSA, 10 mg/ml, New England Biolabs, cat. no. B9001S)
  • 1.5‐ml microcentrifuge tubes
  • Thermocycler
  • QIAquick PCR Purification Kit (Qiagen, cat. no. 28106)
  • Additional reagents and equipment for quantifying microvolumes of DNA ( appendix 3D or )

Basic Protocol 3: Cloning and Sequence Verification of TALEN or TALE‐TF Expression Vectors

  Materials
  • TALEN and/or TALE activator expression vector (Addgene, see Table 12.16.1)
  • BsmBI with NEBuffer 3 (New England Biolabs, cat. no. R0580L)
  • DEPC‐treated water (see recipe)
  • Agencourt AMPure XP beads (Agencourt/Beckman Genomics, cat. no. A63881; for TALENs only)
  • Purified TALE repeat array constructs (see protocol 2)
  • Quick ligation buffer (QLB, see recipe)
  • 400 U/µl T4 DNA Ligase (New England Biolabs, cat. no. M0202L)
  • Chemically competent XL1‐Blue bacterial cells (recA1 endA1 gyrA96 thi‐1 hsdR17 supE44 relA1 lac [F′ proAB lacIq lacZDM15 Tn10 (TetR)]; Stratagene, cat no. 200249)
  • LB medium powder (Difco, cat. no. 244620)
  • LB agar medium powder (Difco, cat. no 244520)
  • Carbenicillin (Sigma, cat. no. C1389)
  • Phusion High‐Fidelity DNA polymerase (Phusion HF) with buffer (New England Biolabs, cat. no. M0530L)
  • 10 mM dNTPs (Roche, cat. no. 11969064001)
  • Primers for colony PCR and sequencing (5 µM each):
    • oSQT 34: 5′‐GACGGTGGCTGTCAAATACCAAGATATG‐3′
    • oSQT 35: 5′‐TCTCCTCCAGTTCACTTTTGACTAGTTGGG‐3′
    • oSQT1: 5′‐AGTAACAGCGGTAGAGGCAG‐3′
    • oSQT3: 5′‐ATTGGGCTACGATGGACTCC‐3′
    • oSQT38: 5′‐TTCGGGAATACGGCGATTG‐3′
    • JDS2980: 5′‐TTAATTCAATATATTCATGAGGCAC‐3′
  • QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106)
  • 1.5‐ml microcentrifuge tubes
  • Thermocycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5), polyacrylamide gel electrophoresis (unit 2.7; optional for TALE‐activators only), and quantifying microvolumes of DNA ( appendix 3D or )
    Table 2.6.1   MaterialsTALEN and TALE‐Activator Expression Vectors

    0.5 domain in vector p65 activation vector VP64 activation vector Nuclease vector
    NI pMLM2581 pMLM3367 pJDS70
    HD pMLM2583 pMLM3585 pJDS71
    NN pMLM2585 pMLM3587 pJDS74
    NG pMLM2579 pMLM3583 pJDS78

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. 2009. Breaking the code of DNA binding specificity of TAL‐type III effectors. Science 326:1509‐1512.
   Bogdanove, A.J. and Voytas, D.F. 2011. TAL effectors: Customizable proteins for DNA targeting. Science 333:1843‐1846.
   Bultmann, S., Morbitzer, R., Schmidt, C.S., Thanisch, K., Spada, F., Elsaesser, J., Lahaye, T., and Leonhardt, H. 2012. Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers. Nucleic Acids Res. 40:5368‐5377.
   Cade, L., Reyon, D., Hwang, W.Y., Tsai, S.Q., Patel, S., Khayter, C., Joung, J.K., Sander, J.D., Peterson, R.T., and Yeh, J.R. 2012. Highly efficient generation of heritable zebrafish gene mutations using homo‐ and heterodimeric TALENs. Nucleic Acids Res. 40:8001‐8010.
   Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. 2011. Efficient design and assembly of custom TALEN and other TAL effector‐based constructs for DNA targeting. Nucleic Acids Res. 39:e82.
   Cong, L., Zhou, R., Kuo, Y.C., Cunniff, M., and Zhang, F. 2012. Comprehensive interrogation of natural TALE DNA‐binding modules and transcriptional repressor domains. Nat. Commun. 3:968.
   Garg, A., Lohmueller, J.J., Silver, P.A., and Armel, T.Z. 2012. Engineering synthetic TAL effectors with orthogonal target sites. Nucleic Acids Res. 40:7584‐7595.
   Geissler, R., Scholze, H., Hahn, S., Streubel, J., Bonas, U., Behrens, S.E., and Boch, J. 2011. Transcriptional activators of human genes with programmable DNA‐specificity. PLoS One 6:e19509.
   Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Jaenisch, R. 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29:731‐734.
   Joung, J.K. and Sander, J.D. 2013. TALENs: A widely applicable technology for targeted genome editing. Nat. Rev. Mol. Cell Biol. 14:49‐55.
   Kuntz, I.D., Chen, K., Sharp, K.A., and Kollman, P.A. 1999. The maximal affinity of ligands. Proc. Natl. Acad. Sci. U.S.A. 96:9997‐10002.
   Maeder, M.L., Linder, S.J., Reyon, D., Angstman, J.F., Fu, Y., Sander, J.D., and Joung, J.K. 2013. Robust, synergistic regulation of human gene expression using TALE activators. Nat. Methods 10:243‐245.
   Mahfouz, M.M., Li, L., Piatek, M., Fang, X., Mansour, H., Bangarusamy, D.K., and Zhu, J.K. 2012. Targeted transcriptional repression using a chimeric TALE‐SRDX repressor protein. Plant Mol. Biol. 78:311‐321.
   Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., and Rebar, E.J. 2011. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29:143‐148.
   Moore, F.E., Reyon, D., Sander, J.D., Martinez, S.A., Blackburn, J.S., Khayter, C., Ramirez, C.L., Joung, J.K., and Langenau, D.M. 2012. Improved somatic mutagenesis in zebrafish using transcription activator‐like effector nucleases (TALENs). PLoS One 7:e37877.
   Moscou, M.J. and Bogdanove, A.J. 2009. A simple cipher governs DNA recognition by TAL effectors. Science 326:1501.
   Perez‐Pinera, P., Ousterout, D.G., Brunger, J.M., Farin, A.M., Glass, K.A., Guilak, F., Crawford, G.E., Hartemink, A.J., and Gersbach, C.A. 2013. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nat. Methods 10:239‐242.
   Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D., and Joung, J.K. 2012. FLASH assembly of TALENs for high‐throughput genome editing. Nat. Biotechnol. 30:460‐465.
   Sander, J.D., Maeder, M.L., Reyon, D., Voytas, D.F., Joung, J.K., and Dobbs, D. 2010. ZiFiT (Zinc Finger Targeter): An updated zinc finger engineering tool. Nucleic Acids Res. 38:W462‐W468.
   Sander, J.D., Cade, L., Khayter, C., Reyon, D., Peterson, R.T., Joung, J.K., and Yeh, J.R. 2011. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat. Biotechnol. 29:697‐698.
   Scholze, H. and Boch, J. 2011. TAL effectors are remote controls for gene activation. Curr. Opin. Microbiol. 14:47‐53.
   Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y., Vincent, A.I., Meng, X., Zhang, L., Gregory, P.D., Anegon, I., and Cost, G.J. 2011. Knockout rats generated by embryo microinjection of TALENs. Nat. Biotechnol. 29:695‐696.
   Tremblay, J.P., Chapdelaine, P., Coulombe, Z., and Rousseau, J. 2012. TALE proteins induced the expression of the frataxin gene. Hum. Gene. Ther. 23:883‐890
   Wang, Z., Li, J., Huang, H., Wang, G., Jiang, M., Yin, S., Sun, C., Zhang, H., Zhuang, F., and Xi, J.J. 2012. An integrated chip for the high‐throughput synthesis of transcription activator‐like effectors. Angew Chem. Int. Ed. Engl. 51:8505‐8508.
   Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Meyer, B.J. 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333:307.
   Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., and Arlotta, P. 2011. Efficient construction of sequence‐specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol. 29:149‐153.
Key Reference
   Reyon et al., 2012. See above.
  This paper describes the development and validation of FLASH for assembling TALE repeat arrays and the archive of 376 plasmids for the α units, extension units, and termination units needed to practice the method. It presents large‐scale studies demonstrating that FLASH‐assembled TALENs offer high activity, a robust success rate, and an essentially limitless targeting range in human cells.
Internet Resources
  http://ZiFiT.partners.org
  Provides access to ZiFiT software for engineering TALENs.
  http://www.addgene.org/talengineering
  TALEN and TALE‐activator expression vectors are available through Addgene.
  http://eGenome.org
  The archive of 376 plasmids required for FLASH are available by request from the Joung lab.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library