Loop‐Mediated Isothermal Amplification for Detection of Nucleic Acids

Nathan A. Tanner1, Thomas C. Evans1

1 New England Biolabs, Ipswich, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 15.14
DOI:  10.1002/0471142727.mb1514s105
Online Posting Date:  January, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Sequence‐specific isothermal nucleic acid amplification techniques are ideally suited for use in molecular diagnostic applications because they do not require thermal cycling equipment and the reactions are typically fast. One of the most widely cited isothermal techniques is termed loop‐mediated isothermal amplification (LAMP). This protocol allows amplification times as fast as 5 to 10 min. Furthermore, various methodologies to detect amplification have been applied to LAMP to increase its utility for the point‐of‐care market. Basic LAMP protocols are provided herein for detection of specific DNA and RNA targets, along with a method to perform multiplex LAMP reactions, permitting even greater flexibility from this powerful technique. Curr. Protoc. Mol. Biol. 105:15.14.1‐15.14.14. © 2014 by John Wiley & Sons, Inc.

Keywords: LAMP; isothermal amplification; molecular diagnostics

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: LAMP Reactions with DNA Templates
  • Alternate Protocol 1: RT‐LAMP Reactions with RNA Templates
  • Alternate Protocol 2: Multiplex LAMP Reactions Using DARQ Primers
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: LAMP Reactions with DNA Templates

  Materials
  • Oligonucleotide primers (typically, 100 µM stocks in H 2O or 1× TE buffer)
    • For human breast cancer 1 (BRCA1; 5′ to 3′):
    • F3: TCCTTGAACTTTGGTCTCC
    • B3: CAGTTCATAAAGGAATTGATAGC
    • FIP: ATCCCCAGTCTGTGAAATTGGGCAAAATGCTGGGATTATAGATGT
    • BIP: GCAGCAGAAAGATTATTAACTTGGGCAGTTGGTAAGTAAATGGAAGA
    • Loop F: AGAACCAGAGGCCAGGCGAG
    • Loop B: AGGCAGATAGGCTTAGACTCAA
  • Test sample
  • Control template DNA (e.g., HeLa genomic DNA, New England Biolabs, 0.1 mg/ml)
  • LoopAmp Extraction kit (Eiken Chemical) or other method for DNA extraction (optional)
  • 2× LAMP reaction buffer (see recipe)
  • Dye for visual detection (optional), such as:
    • 50 µM SYTO‐9 (see recipe, 2 µM final) or other intercalating dsDNA dye
    • 625 µM calcein (see recipe, 25 µM final)
    • 3 mM hydroxynaphthol blue (see recipe, 120 µM final)
    • SYBR Green (Life Technologies/BioRad, 0.1× to 1× final)
  • Strand‐displacing DNA polymerase (e.g., Bst 2.0, large fragment, New England Biolabs, 8,000 U/ml)
  • Molecular‐biology grade water
  • 5 M betaine solution (see recipe; optional)
  • Appropriate plates (with sealing film) or tubes for instrumentation
  • 65°C heating block, thermal cycler, or water bath
  • Fluorescence or turbidity instrument for real‐time detection (e.g., LA‐320c, SA‐Scientific; ESE‐Quant, Qiagen; CFX, Bio‐Rad)

Alternate Protocol 1: RT‐LAMP Reactions with RNA Templates

  Additional Materials (also see protocol 1Basic Protocol)
  • Oligonucleotide primers (typically, 100 µM stocks in H 2O or 1× TE buffer)
    • For human hydroxymethylbilane synthase (HMBS2; 5′ to 3′):
    • F3: AGAGTGATTCGCGTGGGTA
    • B3: ACTTCATTCTTCTCCAGGGC
    • FIP: TCAAACTGCAGGCCAGGGTACCAGCTTGCTCGCATACAGAC
    • BIP: TTGCTATGTCCACCACAGGGGAAGCTCCTTGGTAAACAGGC
    • Loop F: GTTGCCACCACACTGTCC
    • Loop B: CAAGATTCTTGATACTGCACTCTCT
  • Control template RNA (e.g., Jurkat RNA, Ambion)
  • Reverse transcriptase (e.g., AMV RT, New England Biolabs 10,000 U/ml)
  • RNase‐free water

Alternate Protocol 2: Multiplex LAMP Reactions Using DARQ Primers

  Additional materials (also see protocol 1Basic Protocol)
  • Oligonucleotide primers (typically, 100 µM stocks in H 2O or 1× TE buffer)
    • Set 1 (e.g., for E. coli dnaE):
    • F3: GATCACCGATTTCACCAACC
    • B3: CTTTTGAGATCAGCAACGTCAG
    • FIP: 5′‐IAbRQ‐CTGCCCCGACGATAGGCTTAATCGTGGTCTGGTGAAGTTC TACGG (Fd complement underlined)
    • Fd: ATTAAGCCTATCGTCGGGGCAG‐Cy5‐3′
    • BIP: TCCAGTGCGACCTGCTGGGTGGGTATTGTTCGCCGCCAGTAC
    • Loop F: TGCGCCATGTCCCGCT
    • Loop B: TGAGTTAACCCACCTGACG
    • Set 2 (e.g., for HMBS2):
    • F3: AGCAACATAGGTTTCAGTTC
    • B3: CTGTGAACGGTCATCACC
    • FIP: 5′‐IAbRQ‐GATTCCACTTCCAACGTCGTTGCATAGGCATTGTATCCAGAGTG (Fd complement underlined)
    • Fd: CAACGACGTTGGAAGTGGAATC‐Rox_N‐3′
    • BIP: CGAAGTGAACCTTGTCAACATGAGACTACCCACATCGTTACC
    • Loop F: ACGGACATGTCGATCATGGA
    • Loop B: CGTCTCCCTTCAATCCGATGGC
  • Control template DNA (e.g., E. coli genomic DNA, Affymetrix)
  • Intercalating dsDNA dye, e.g., SYTO‐9 (see recipe; optional; for independent validation of amplification)
  • Multichannel fluorometer/thermocycler (e.g., Bio‐Rad CFX‐96)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aonuma, H., Yoshimura, A., Kobayashi, T., Okado, K., Badolo, A., Nelson, B., Kanuka, H., and Fukumoto, S. 2010. A single fluorescence‐based LAMP reaction for identifying multiple parasites in mosquitoes. Exp. Parasitol. 125:179‐183.
  Gandelman, O.A., Church, V.L., Moore, C.A., Kiddle, G., Carne, C.A., Parmar, S., Jalal, H., Tisi, L.C., and Murray, J.A. 2010. Novel bioluminescent quantitative detection of nucleic acid amplification in real‐time. PLoS One 5:e14155.
  Goto, M., Honda, E., Ogura, A., Nomoto, A., and Hanaki, K. 2009. Colorimetric detection of loop‐mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 46:167‐172.
  He, L. and Xu, H. 2010. Development of a multiplex loop‐mediated isothermal amplification (mLAMP) method for the simultaneous detection of white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp. Aquaculture 311:94‐99.
  Kaneko, H., Kawana T., Fukushima, E., and Suzutani, T. 2007. Tolerance of loop‐mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70:499‐501.
  Liang, C., Chu, Y., Cheng, S., Wu, H., Kajiyama, T., Kambara, H., and Zhou, G. 2012. Multiplex LAMP detection by sequence‐based barcodes coupled with NEase‐mediated Pyrosequencing. Anal. Chem. 84:3758‐3763.
  Monis, P.T., Giglio, S., and Saint, C.P. 2005. Comparison of SYTO9 and SYBR Green I for real‐time polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Anal. Biochem. 340:24‐34.
  Mori, Y., Kitao, M., Tomita, N., and Notomi, T. 2004. Real‐time turbidimetry of LAMP reaction for quantifying template DNA. J. Biochem. Biophys. Methods 59:145‐157.
  Murray, L., Edwards, L., Tuppurainen, E.S.M., Bachanek‐Bankowska, K., Oura, C., Mioulet, V., and King, D.P. 2013. Detection of capripoxvirus DNA using a novel loop‐mediated isothermal amplification assay. BMC Vet. Res. 9:90.
  Nagamine, K., Hase, T., and Notomi, T. 2002. Accelerated reaction by loop‐mediated isothermal amplification using loop primers. Mol. Cell. Probes 16:223‐229.
  Niemz, A., Ferguson, T.M., and Doyle, D.S. 2011. Point‐of‐care nucleic acid testing for infectious diseases. Trends Biotechnol. 29:240‐250.
  Njiru, Z.K. 2012. Loop‐mediated isothermal amplification technology: Towards point of care diagnostics. PLoS Negl. Trop. Dis. 6:e1572.
  Njiru, Z.K., Jikosza, A.S.J., Armstrong, T., Enyaru, J.C., Ndung'u, J.M., and Thompson, A.R.C. 2008. Loop‐mediated isothermal amplification method for rapid detection of trypanosoma brucie rhodensie. PLoS Negl. Trop. Dis. 2:e147.
  Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T. 2000. Loop‐mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63.
  Poole, C.B., Tanner, N.A., Zhang, Y., Evans T.C. Jr., and Carlow, C.K. 2012. Diagnosis of brugian filariasis by loop‐mediated isothermal amplification. PLoS Negl. Trop. Dis. 6:e1948.
  Seetang‐Nun, Y., Jaroenram, W., Sriurairatana, S., Suebsing, R., and Kiatpathomchai, W. 2013. Visual detection of white spot syndrome virus using DNA‐functionalized gold nanoparticles as probes combined with loop‐mediated isothermal amplification. Mol. Cell. Probes 27:71‐79.
  Tanner, N.A., Zhang, Y., and Evans, T.C. Jr. 2012. Simultaneous multiple target detection in real‐time loop‐mediated isothermal amplification. Biotechniques 53:81‐89.
  Tomita, N., Mori, Y., Kanda, H., and Notomi, T. 2008. Loop‐mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 3:877‐882.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library