Mapping Transposon Insertions in Bacterial Genomes by Arbitrarily Primed PCR

José T. Saavedra1, Julia A. Schwartzman2, Michael S. Gilmore2

1 Department of Ophthalmology, Massachusetts Eye and Ear Infirmary, Boston, Massachusetts, 2 The Broad Institute, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 15.15
DOI:  10.1002/cpmb.38
Online Posting Date:  April, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Transposons can be used to easily generate and label the location of mutations throughout bacterial and other genomes. Transposon insertion mutants may be screened for a phenotype as individual isolates, or by selection applied to a pool of thousands of mutants. Identifying the location of a transposon insertion is critical for connecting phenotype to the genetic lesion. In this unit, we present an easy and detailed approach for mapping transposon insertion sites using arbitrarily‐primed PCR (AP‐PCR). Two rounds of PCR are used to (1) amplify DNA spanning the transposon insertion junction, and (2) increase the specific yield of transposon insertion junction fragments for sequence analysis. The resulting sequence is mapped to a bacterial genome to identify the site of transposon insertion. In this protocol, AP‐PCR as it is routinely used to map sites of transposon insertion within Staphylococcus aureus, is used to illustrate the principle. Guidelines are provided for adapting this protocol for mapping insertions in other bacterial genomes. Mapping transposon insertions using this method is typically achieved in 2 to 3 days if starting from a culture of the transposon insertion mutant. © 2017 by John Wiley & Sons, Inc.

Keywords: transposon; arbitrarily primed PCR; anchored PCR; gene‐walking PCR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Mapping Transposon Insertion Sites Using AP‐PCR
  • Support Protocol 1: Isolation of Bacterial DNA for AP‐PCR
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Mapping Transposon Insertion Sites Using AP‐PCR

  Materials
  • Oligonucleotide Primers (IDT; see Table 15.15.1)
  • DNA or cell lysate (see protocol 2Support Protocol)
  • dNTP Mix (New England Biolabs, cat. no. N0447S)
  • Q5 High‐Fidelity DNA Polymerase (New England Biolabs, cat. no. M0491L) containing: 5× Q5 Reaction buffer
  • DNase‐free Ultra Pure Water (VWR cat. no. 10128‐466)
  • Agarose (VWR, cat. no. VW1468‐07)
  • Components for TBE electrophoresis running buffer:
    • Tris base (VWR, cat. no. 71003‐490)
    • Boric acid (VWR, cat. no. BDH9222‐500G)
    • EDTA, pH 8.0 (VWR, cat. no. BDH9232‐500G)
  • Qiaquick PCR Purification Kit (Qiagen, cat. no. 28106) containing:
    • DNeasy mini spin columns in 2‐ml collections tubes
    • Buffer PB
    • Buffer PE
    • pH Indicator
    • Buffer EB
  • ExoSAP‐IT (NEB, cat. no. 95026‐710), optional
  • Qiaquick Gel Extraction kit (Qiagen, cat. no. 28074) containing:
    • Buffer QG
    • Buffer PE
    • Qiaquick spin columns
    • EB Buffer
    • Ethidium bromide (VWR, cat. no. 97064‐602)
    • Isopropyl alcohol (VWR, cat. no. BDH1174‐4LP)
    • PCR 8‐Well Strip Tubes (VWR, cat. no. 82006‐606)
    • Low‐Speed Centrifuge with PCR‐Tube Adaptor
    • Thermal Cycler
    • Electrophoresis Gel Tray
    • UV Trans‐Illuminator
    • Nanodrop instrument
    • Sequence editor (e.g., Geneious or open‐source BioPython)
    • Tabletop centrifuge
    • 50°C water bath
Table 5.5.1   MaterialsPrimer Sequences

Target Primer Name Sequence (5′ to 3′) a T m b Source c
Transposon
Tn5 1_F Tn5ext GAACGTTACCATGTTAGGAGGTC 55 1
2_F Tn5int CGGGAAAGGTTCCGTTCAGGACGC 64
Tn10d(Cm) 1_F CmExt CAGGCTCTCCCCGTGGAGG 63 2
2_F CmInt CTGCCTCCCAGAGCCTG 58
Tn10d(Kn) 1_F KnExt CCGCGGTGGAGCTCC 60 3
2_F KnInt ATGACAAGATGTGTATCCACC 52
Tn917(Em) 1_F MartnF TTTATGGTACCATTCATTTTCCTGCTTTTTC 57 4
2_F MjmF CCAAAATCCGTTCCTTTTTCATAGTTCCTATATAGTTATACGC 61
Tn4351(Em) 1_F Tet‐1 TGTCGTAGTTGCTCTGTCGGGTAA 60 5
2_F 1030 TAGCAAACTTTATCCATTCAG 48
Tn551(Em) 1_F Erm5.3 TCTACATTACGCATTTGGAATAC 51 6
2_F Erm5.2 AGATAATGCACTATCAACACACTC 53
Chromosome
Any 1_R ARB1 GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT 7
1_R ARB6 GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC
2_R ARB2 GGCCACGCGTCGACTAGTAC 60

 aBold residues indicate the Round 2 reverse product. Underlined residues indicate the 3′ pentamer.
 bT m, primer melting temperature in °C. Estimated in silico.
 cSources as follows: 1, (Simon, Quandt, & Klipp, ); 2, (Kleckner, Bender, & Gottesman, ); 3, (Alexeyev & Shokolenko, ); 4, (Bae, Glass, Schneewind, & Missiakas, ; Knobloch et al., ); 5, (Chen et al., ); 6, (Li et al., ); 7, (O'Toole et al., ).
CAUTION: Ethidium bromide is toxic and potentially mutagenic. Wearing gloves and working with this chemical in designated areas, and safe disposal of waste as specified by your institutional chemical safety guidelines are advised.CAUTION: UV, especially shorter wavelengths below 365 nm, can damage the eye, and exposure is carcinogenic for the skin. Wear proper protective equipment when visualizing ethidium‐bromide stained agarose gels using UV illumination.

Support Protocol 1: Isolation of Bacterial DNA for AP‐PCR

  Materials
  • Strain of interest from frozen stocks
  • Brain Heart Infusion (BHI) broth (VWR, cat. no. 90003‐032)
  • Technical agar (VWR, cat. no. 90004‐030)
  • Erythromycin (VWR, cat. no. TCE0751‐25G)
  • Tris‐EDTA, pH 8.0 (VWR, cat. no. 97062‐626)
  • Lysostaphin (see recipe)
  • Lysozyme (see recipe), optional
  • DNeasy Blood & Tissue kit (Qiagen, cat. no. 69504) containing:
    • DNeasy mini spin columns in 2‐ml collections tubes
    • 2‐ml collection tubes
    • Buffer ATL
    • Buffer AL
    • Buffer AW1
    • Buffer AW2
    • Buffer AE
    • Proteinase K
  • Dehydrated ethanol, 200 Proof (VWR, cat. no. 89085‐244)
  • Inoculating loops (VWR, cat. no. 12000‐810)
  • Petri dishes (VWR, cat. no. 25384‐302)
  • 37°C incubator
  • Sterile culture tubes (VWR, cat. no. 60818‐689)
  • Shaker
  • 1.7‐ml centrifuge tubes (VWR, cat. no. 87003‐294)
  • Tabletop centrifuge
  • Spectrophotometer (e.g., Nanodrop)
CAUTION: Toxin‐expressing S. aureus is a select agent. Observe appropriate containment measures.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Alexeyev, M. F., & Shokolenko, I. N. (1995). Mini‐Tn10 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram‐negative bacteria. Gene, 160, 59–62. doi: 10.1016/0378‐1119(95)00141‐R
  Bae, T., Glass, E. M., Schneewind, O., & Missiakas, D. (2008). Generating a collection of insertion mutations in the Staphylococcus aureus genome using bursa aurealis. In A. L. Osterman, & S. Y. Gerdes (Eds.), Microbial gene essentiality: Protocols and bioinformatics (pp. 103–116). Totowa, NJ, USA: Humana Press. doi: 10.1007/978‐1‐59745‐321‐9_7
  Ballering, K. S., Kristich, C. J., Grindle, S. M., Oromendia, A., Beattie, D. T., & Dunny, G. M. (2009). Functional genomics of Enterococcus faecalis: Multiple novel genetic determinants for biofilm formation in the core genome. Journal of Bacteriology, 191, 2806–2814. doi: 10.1128/JB.01688‐08
  Brennan, C. A., Mandel, M. J., Gyllborg, M. C., Thomasgard, K. A., & Ruby, E. G. (2013). Genetic determinants of swimming motility in the squid light‐organ symbiont Vibrio fischeri. Microbiologyopen, 2, 576–594. doi: 10.1002/mbo3.96
  Brooks, J. F., Gyllborg, M. C., Cronin, D. C., Quillin, S. J., Mallama, C. A., Foxall, R., … Mandel, M. J. (2014). Global discovery of colonization determinants in the squid symbiont Vibrio fischeri. Proceedings of the National Academy of Sciences of the United States of America, 111, 17284–17289. doi: 10.1073/pnas.1415957111
  Burns, K. H., & Boeke, J. D. (2012). Human transposon tectonics. Cell, 149, 740–752. doi: 10.1016/j.cell.2012.04.019
  Caetano‐Anolles, G. (1993). Amplifying DNA with arbitrary oligonucleotide primers. Genome Research, 3, 85–94. doi: 10.1101/gr.3.2.85
  Caetano‐Anollés, G., & Bassam, B. J. (1993). DNA amplification fingerprinting using arbitrary oligonucleotide primers. Applied Biochemistry and Biotechnology, 42, 189–200. doi: 10.1007/BF02788052
  Cameron, D. E., Urbach, J. M., & Mekalanos, J. J. (2008). A defined transposon mutant library and its use in identifying motility genes in Vibrio cholerae. Proceedings of the National Academy of Sciences of the United States of America, 105, 8736–8741. doi: 10.1073/pnas.0803281105
  Chen, T., Yong, R., Dong, H., & Duncan, M. J. (1999). A general method for direct sequencing of transposon mutants by randomly primed PCR. Technical Tips Online, 4, 58–61. doi: 10.1016/S1366‐2120(08)70140‐5
  Chiang, S. L., & Mekalanos, J. J. (1998). Use of signature‐tagged transposon mutagenesis to identify Vibrio cholerae genes critical for colonization. Molecular Microbiology, 27, 797–805. doi: 10.1046/j.1365‐2958.1998.00726.x
  Craig, N. L. (1997). Target site selection in transposition. Annual Review of Biochemistry, 66, 437–474. doi: 10.1146/annurev.biochem.66.1.437
  Daboussi, M. J., & Capy, P. (2003). Transposable elements in filamentous fungi. Annual Review of Microbiology, 57, 275–299. doi: 10.1146/annurev.micro.57.030502.091029
  Das, S., Noe, J. C., Paik, S., & Kitten, T. (2005). An improved arbitrary primed PCR method for rapid characterization of transposon insertion sites. Journal of Microbiological Methods, 63, 89–94. doi: 10.1016/j.mimet.2005.02.011
  Dziva, F., van Diemen, P. M., Stevens, M. P., Smith, A. J., & Wallis, T. S. (2004). Identification of Escherichia coli O157: H7 genes influencing colonization of the bovine gastrointestinal tract using signature‐tagged mutagenesis. Microbiology, 150, 3631–3645. doi: 10.1099/mic.0.27448‐0
  Edgar, R. C. (2004). MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797. doi: 10.1093/nar/gkh340
  Fernandez‐Martinez, L., Del Sol, R., Evans, M., Fielding, S., Herron, P., Chandra, G., & Dyson, P. (2011). A transposon insertion single‐gene knockout library and new ordered cosmid library for the model organism Streptomyces coelicolor A3 (2). Antonie Van Leeuwenhoek, 99, 515–522. doi: 10.1007/s10482‐010‐9518‐1
  Fuller, T. E., Kennedy, M. J., & Lowery, D. E. (2000). Identification of Pasteurella multocida virulence genes in a septicemic mouse model using signature‐tagged mutagenesis. Microbial Pathogenesis, 29, 25–38. doi: 10.1006/mpat.2000.0365
  Goodman, A. L., Kulasekara, B., Rietsch, A., Boyd, D., Smith, R. S., & Lory, S. (2004). A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Developmental Cell, 7, 745–754. doi: 10.1016/j.devcel.2004.08.020.
  Goodman, A. L., McNulty, N. P., Zhao, Y., Leip, D., Mitra, R. D., Lozupone, C. A., … Gordon, J. I. (2009). Identifying genetic determinants needed to establish a human gut symbiont in its habitat. Cell Host & Microbe, 6, 279–289. doi: 10.1016/j.chom.2009.08.003
  Goodman, A. L., Wu, M., & Gordon, J. I. (2011). Identifying microbial fitness determinants by insertion sequencing using genome‐wide transposon mutant libraries. Nature Protocols, 6, 1969–1980. doi: 10.1038/nprot.2011.417
  Graf, J., Dunlap, P. V., & Ruby, E. G. (1994). Effect of transposon‐induced motility mutations on colonization of the host light organ by Vibrio fischeri. Journal of Bacteriology, 176, 6986–6991.
  Hartl, D. L. (2001). Discovery of the transposable element mariner. Genetics, 157, 471–476.
  Hava, D. L., & Camilli, A. (2002). Large‐scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Molecular Microbiology, 45, 1389–1406. doi: 10.1046/j.1365‐2958.2002.03106.x/full
  Hendrixson, D. R., Akerley, B. J., & DiRita, V. J. (2001). Transposon mutagenesis of Campylobacter jejuni identifies a bipartite energy taxis system required for motility. Molecular Microbiology, 40, 214–224. doi: 10.1046/j.1365‐2958.2001.02376.x
  Hoskisson, P. A., Rigali, S., Fowler, K., Findlay, K. C., & Buttner, M. J. (2006). DevA, a GntR‐like transcriptional regulator required for development in Streptomyces coelicolor. Journal of Bacteriology, 188, 5014–5023. doi: 10.1128/JB.00307‐06
  Hutchison, C. A., Peterson, S. N., Gill, S. R., Cline, R. T., White, O., Fraser, C. M., … Venter, J. C. (1999). Global transposon mutagenesis and a minimal Mycoplasma genome. Science, 286, 2165–2169. doi: 10.1126/science.286.5447.2165
  Kapitonov, V. V., Makarova, K. S., & Koonin, E. V. (2017). ISC, a novel group of bacterial and archaeal DNA transposons that encode Cas9 homologs. Journal of Bacteriology, 198, 797–807. doi: 10.1128/JB.00783‐15
  Kavermann, H., Burns, B. P., Angermüller, K., Odenbreit, S., Fischer, W., Melchers, K., & Haas, R. (2003). Identification and characterization of Helicobacter pylori genes essential for gastric colonization. The Journal of Experimental Medicine, 197, 813–822. doi: 10.1084/jem.20021531
  Kleckner, N. (1981). Transposable elements in prokaryotes. Annual Review of Genetics, 15, 341–404. doi: 10.1146/annurev.ge.15.120181.002013
  Kleckner, N., Bender, J., & Gottesman, S. (1991). [7] Uses of transposons with emphasis on Tn10. Methods in Enzymology, 204, 139–180. doi: 10.1016/0076‐6879(91)04009‐D
  Knobloch, J. K.‐M., Nedelmann, M., Kiel, K., Bartscht, K., Horstkotte, M. A., Dobinsky, S., … Mack, D. (2003). Establishment of an arbitrary PCR for rapid identification of Tn917 insertion sites in Staphylococcus epidermidis: Characterization of biofilm‐negative and nonmucoid mutants. Applied and Environmental Microbiology, 69, 5812–5818. doi: 10.1128/AEM.69.10.5812‐5818.2003
  Lauro, F. M., Tran, K., Vezzi, A., Vitulo, N., Valle, G., & Bartlett, D. H. (2008). Large‐scale transposon mutagenesis of Photobacterium profundum SS9 reveals new genetic loci important for growth at low temperature and high pressure. Journal of Bacteriology, 190, 1699–1709. doi: 10.1128/JB.01176‐07
  Lee, S. H., Butler, S. M., & Camilli, A. (2001). Selection for in vivo regulators of bacterial virulence. Proceedings of the National Academy of Sciences of the United States of America, 98, 6889–6894. doi: 10.1073/pnas.111581598
  Li, W., Cowley, A., Uludag, M., Gur, T., McWilliam, H., Squizzato, S., … Lopez, R. (2015). The EMBL‐EBI bioinformatics web and programmatic tools framework. Nucleic Acids Research, 43, W580‐W584. doi: 10.1093/nar/gkv279
  Li, M., Rigby, K., Lai, Y., Nair, V., Peschel, A., Schittek, B., & Otto, M. (2009). Staphylococcus aureus mutant screen reveals interaction of the human antimicrobial peptide dermcidin with membrane phospholipids. Antimicrob Agents Chemother, 53, 4200–4210. doi: 10.1128/AAC.00428‐09
  Liberati, N. T., Urbach, J. M., Miyata, S., Lee, D. G., Drenkard, E., Wu, G., … Ausubel, F. M. (2006). An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proceedings of the National Academy of Sciences of the United States of America, 103, 2833–2838. doi: 10.1073/pnas.0511100103
  Lin, T., Gao, L., Zhang, C., Odeh, E., Jacobs, M. B., Coutte, L., … Norris, S. J. (2012). Analysis of an ordered, comprehensive STM mutant library in infectious Borrelia burgdorferi: Insights into the genes required for mouse infectivity. PLoS One, 7, e47532. doi: 10.1371/journal.pone.0047532
  Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L., & Davis, M. M. (1989). Polymerase chain reaction with single‐sided specificity: Analysis of T cell receptor delta chain. Science, 243, 217–220. doi: 10.1126/science.2463672
  Loo, C., Corliss, D., & Ganeshkumar, N. (2000). Streptococcus gordonii biofilm formation: Identification of genes that code for biofilm phenotypes. Journal of Bacteriology, 182, 1374–1382. doi: 10.1128/JB.182.5.1374‐1382.2000
  Luong, T. T., Newell, S. W., & Lee, C. Y. (2003). Mgr, a novel global regulator in Staphylococcus aureus. Journal of Bacteriology, 185, 3703–3710. doi: 10.1128/JB.185.13.3703‐3710.2003
  Mazurkiewicz, P., Tang, C. M., Boone, C., & Holden, D. W. (2006). Signature‐tagged mutagenesis: Barcoding mutants for genome‐wide screens. Nature Reviews Genetics, 7, 929–939. doi: 10.1038/nrg1984
  McClintock, B. (1948). Mutable loci in maize. Year book ‐ Carnegie Institution of Washington, 47, 155–169.
  McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y. M., Buso, N., … Lopez, R. (2013). Analysis tool web services from the EMBL‐EBI. Nucleic Acids Research, 41, W597‐W600. doi: 10.1093/nar/gkt376
  Morgan, E., Campbell, J. D., Rowe, S. C., Bispham, J., Stevens, M. P., Bowen, A. J., … Wallis, T. S. (2004). Identification of host‐specific colonization factors of Salmonella enterica serovar Typhimurium. Molecular Microbiology, 54, 994–1010. doi: 10.1111/j.1365‐2958.2004.04323.x
  Ochman, H., Gerber, A. S., & Hartl, D. L. (1988). Genetic applications of an inverse polymerase chain reaction. Genetics, 120, 621–623.
  O'Toole, G. A., Gibbs, K. A., Hager, P. W., Phibbs, P. V., & Kolter, R. (2000). The global carbon metabolism regulator Crc is a component of a signal transduction pathway required for biofilm development by Pseudomonas aeruginosa. Journal of Bacteriology, 182, 425–431. doi: 10.1128/JB.182.2.425‐431.2000
  O'Toole, G. A., Pratt, L. A., Watnick, P. I., Newman, D. K., Weaver, V. B., & Kolter, R. (1999). [6]Genetic approaches to study of biofilms. Methods in Enzymology, 310, 91–109. doi: 10.1016/S0076‐6879(99)10008‐9
  Parker, J. D., Rabinovitch, P. S., & Burmer, G. C. (1991). Targeted gene walking polymerase chain reaction. Nucleic Acids Research, 19, 3055–3060. doi: 10.1093/nar/19.11.3055
  Peterson, C. N., Carabetta, V. J., Chowdhury, T., & Silhavy, T. J. (2006). LrhA regulates rpoS translation in response to the Rcs phosphorelay system in Escherichia coli. Journal of Bacteriology, 188, 3175–3181. doi: 10.1128/JB.188.9.3175‐3181.2006
  Plasterk, R. H., Izsvák, Z., & Ivics, Z. (1999). Resident aliens: The Tc1/mariner superfamily of transposable elements. Trends in Genetics, 15, 326–332. doi: 10.1016/S0168‐9525(99)01777‐1
  Reznikoff, W. S. (1993). The Tn5 transposon. Annual Review of Microbiology, 47, 945–964. doi: 10.1146/annurev.mi.47.100193.004501
  Salama, N. R., Shepherd, B., & Falkow, S. (2004). Global transposon mutagenesis and essential gene analysis of Helicobacter pylori. Journal of Bacteriology, 186, 7926–7935. doi: 10.1128/JB.186.23.7926‐7935.2004
  Simon, R., Quandt, J., & Klipp, W. (1989). New derivatives of transposon Tn5 suitable for mobilization of replicons, generation of operon fusions and induction of genes in Gram‐negative bacteria. Gene, 80, 161–169. doi: 10.1016/0378‐1119(89)90262‐X
  Tsou, A. M., Liu, Z., Cai, T., & Zhu, J. (2011). The VarS/VarA two‐component system modulates the activity of the Vibrio cholerae quorum‐sensing transcriptional regulator HapR. Microbiology, 157, 1620–1628. doi: 10.1099/mic.0.046235‐0
  Urbach, J. M., Wei, T., Liberati, N., Grenfell‐Lee, D., Villanueva, J., Wu, G., & Ausubel, F. M. (2009). Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries. Current protocols in molecular biology/edited by Frederick M. Ausubel. [et al.], 86, 19.7:19.7.1–19.7.34. doi: 10.1002/0471142727.mb1907s86
  van Opijnen, T., Bodi, K. L., & Camilli, A. (2009). Tn‐seq: High‐throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nature Methods, 6, 767–772. doi: 10.1038/nmeth.1377
  Watnick, P. I., & Kolter, R. (1999). Steps in the development of a Vibrio cholerae El Tor biofilm. Molecular Microbiology, 34, 586–595. doi: 10.1046/j.1365‐2958.1999.01624.x
  Welsh, J., & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research, 18, 7213–7218. doi: 10.1093/nar/18.24.7213
  Worley, M. J., Ching, K. H., & Heffron, F. (2000). Salmonella SsrB activates a global regulon of horizontally acquired genes. Molecular Microbiology, 36, 749–761. doi: 10.1046/j.1365‐2958.2000.01902.x
Internet Resources
  https://www.python.org/
  Documentation and source code for Python programming language
  http://biopython.org/
  Biopython documentation and source code Note that a useful instruction manual called the Biopython cookbook is available in the documentation.
  http://www.ebi.ac.uk/Tools/msa/muscle/
  Web host for the MUSCLE algorithm
  http://www.ncbi.nlm.nih.gov/books/NBK279688/
  Instructions for making a local database using command line programming.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library