Parallel Protein Detection by Solid‐Phase Proximity Ligation Assay with Real‐Time PCR or Sequencing

Tonge Ebai1, Masood Kamali‐Moghaddam1, Ulf Landegren1

1 Department of Immunology, Genetics and Pathology, Science for Life Laboratory, Uppsala Biomedical Center, Uppsala University, Uppsala
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 20.10
DOI:  10.1002/0471142727.mb2010s109
Online Posting Date:  January, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Proximity ligation assays are a group of protein detection techniques in which reagents with affinity for target proteins, typically antibodies, are coupled to short strands of DNA. DNA‐modified affinity reagents are combined in assays constructed such that the coordinated binding of individual target molecules or complexes of interacting proteins by two or more of the reagents, followed by DNA ligation and/or polymerization reactions, gives rise to amplifiable DNA reporter strands. Proximity ligation assays have been shown to exhibit excellent sensitivity in single and multiplexed protein assays for individual or interacting proteins, both in solution and in situ. This unit describes procedures for developing solid‐phase proximity ligation assays for soluble proteins using either real‐time PCR or DNA sequencing as the readout. In addition, critical steps for assay optimization are discussed. © 2015 by John Wiley & Sons, Inc.

Keywords: SP‐PLA; NGS; qPCR; PTM; PLA probes

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Solid‐Phase Proximity Ligation Assay for High‐Specificity Detection of Low‐Abundance Proteins
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Solid‐Phase Proximity Ligation Assay for High‐Specificity Detection of Low‐Abundance Proteins

  Materials
  • Sulfosuccinimidyl‐4 (SMCC; Thermo Scientific, cat. no. 22322)
  • Unconjugated and/or biotinylated antibodies against target protein (see Strategic Planning):
  • Two unconjugated or biotinylated antibodies for PLA probes
  • One biotinylated antibody for protein capture
  • PBS (see recipe)
  • Dithiothreitol (DTT; Sigma‐Aldrich, cat. no. D0632)
  • Conjugation buffer (see recipe)
  • Paired probe oligonucleotides (Tables 20.10.1 and 20.10.4) with desired modification (select one):
    • 100 μM thiol‐modified oligonucleotides
    • 100 nM streptavidin‐conjugated oligonucleotides (Solulink)
  • Storage buffer (see recipe)
  • Additional oligonucleotides (Tables 20.10.1 to 20.10.3)
  • 10 mg/ml Dynabeads MyOne streptavidin T1 (Life Technologies, cat. no. 65602)
  • Wash buffer (see recipe)
  • Sample of interest (e.g., plasma, serum, or whole blood)
  • Recombinant target protein for standard curve
  • PLA buffer
  • 50 mM MgCl 2
  • 10 μM TaqMan probe (IDT): 5′‐FAM‐TGACGAACCGCTTTGCCTGA‐MBG‐3′
  • 100 mM ATP (Thermo Scientific, cat. no. R0441)
  • 25 mM dNTPs (A, C, G, U; Thermo Scientific, cat. no. V0195)
  • 5 U/μl AccuStart Taq DNA polymerase with 10× PCR buffer (Quanta Biosciences, cat. no. 95061‐05K)
  • 1 U/μl T4 DNA ligase (Thermo Scientific, cat. no. EL0016)
  • 1 U/μl uracil‐DNA glycosylase (UDG; Thermo Scientific, cat. no. EN0362)
  • 10,000× SYBR Green I nucleic acid gel stain (Life Technologies, cat. no. S‐7563)
  • Dimethyl sulfoxide (DMSO; Sigma‐Aldrich, cat. no. 41648)
  • 5 U/μl Ampligase DNA ligase and 10× reaction buffer (Epicentre Biotechnology, cat. nos. A3210K and A1905B)
  • Zeba Spin desalting columns or plates, 7‐kDa MWCO (Thermo Scientific, cat. no. 89882 for 0.5‐ml columns or 89809 for plates)
  • Slide‐A‐Lyzer Mini dialysis devices, 7‐kDa MWCO (Thermo Scientific, cat. no. 69562)
  • 1.5‐ml microcentrifuge tubes
  • DynaMag‐2 Magnet and DynaMag‐96 Side Magnet (Life Technologies, cat. nos. 12321D and 12331D)
  • Rotator (Giant Bio PTR‐30 360 degree vertical multifunctional rotator)
  • PCR microtiter plate or PCR strips
  • Self‐adhesive PCR film
  • Plate centrifuge
  • Mx3005P qPCR system (Agilent Technologies)
  • Multichannel pipettor (optional)
  • 2720 thermal cycler (Applied Bioscience, cat. no. 4359659)
  • 7900 HT fast real‐time PCR system (Applied Bioscience, cat. no. 4329001)
  • 384‐well MicroAmp optical reaction plate with bar code
  • Hydra 96 microdispenser system (Robbins Scientific)
  • GFX columns (GE Healthcare, cat. no. D0632)
  • 2% (w/v) E‐gel precast agarose gel (Life Technologies, cat. no. G402002)
  • E‐gel agarose gel electrophoresis system (Life Technologies, cat. no. G6500)
  • 50‐bp DNA size ladder
Table 0.0.1   MaterialsOligonucleotides for Singleplex SP‐PLA

Name Sequence (5′ to 3′)
SLC1 CGCATCGCCCTTGGACTACGACTGACGAACCGCTTTGCCTGACTGATCGCTAAATCGTG
SLC2 TCGTGTCTAAAGTCCGTTACCTTGATTCCCCTAACCCTCTTGAAAAATTCGGCATCGGTGA
Biosplint TACTTAGACACGACACGATTTAGTTT
Bioforward (Biofwd) CATCGCCCTTGGACTACGA
Bioreverse (Biorev) GGGAATCAAGGTAACGGACTTTAG

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abd‐Elsalam, K.A. 2003. Bioinformatic tools and guideline for PCR primer design. African J. Biotechnol. 2:91‐95.
  Anderson, N.L. and Anderson, N.G. 2002. The human plasma proteome: History, character, and diagnostic prospects. Mol. Cell Proteom. 1:845‐867.
  Anderson, L. and Hunter, C.L. 2006. Quantitative mass spectrometric multiple reaction monitoring assays for major plasma proteins. Mol. Cell Proteom. 5:573‐588.
  Berna, M. and Ackermann, B. 2009. Increased throughput for low‐abundance protein biomarker verification by liquid chromatography/tandem mass spectrometry. Anal. Chem. 81:3950‐3956.
  Darmanis, S., Nong, R.Y., Hammond, M., Gu, J., Alderborn, A., Vanelid, J., Siegbahn, A., Gustafsdottir, S., Ericsson, O., Landegren, U., and Kamali‐Moghaddam, M. 2010. Sensitive plasma protein analysis by microparticle‐based proximity ligation assays. Mol. Cell Proteom. 9:327‐335.
  Darmanis, S., Nong, R.Y., Vänelid, J., Siegbahn, A., Ericsson, O., Fredriksson, S., Bäcklin, C., Gut, M., Heath, S., Gut, I.G., Wallentin, L., Gustafsson, M.G., Kamali‐Moghaddam, M., and Landegren, U. 2011. ProteinSeq: High‐performance proteomic analyses by proximity ligation and next generation sequencing. PLoS One 6:e25583.
  Fredriksson, S., Gullberg, M., Jarvius, J., Olsson, C., Pietras, K., Gustafsdottir, S.M., Ostman, A., and Landegren, U. 2002. Protein detection using proximity‐dependent DNA ligation assays. Nat. Biotechnol. 20:473‐477.
  Fredriksson, S., Dixon, W., Ji, H., Koong, A.C., Mindrinos, M., and Davis, R.W. 2007. Multiplexed protein detection by proximity ligation for cancer biomarker validation. Nat. Methods 4:327‐329.
  Fredriksson, S., Horecka, J., Brustugun, O.T., Schlingemann, J., Koong, A.C., Tibshirani, R., and Davis, R.W. 2008. Multiplexed proximity ligation assays to profile putative plasma biomarkers relevant to pancreatic and ovarian cancer. Clin. Chem. 54:582‐589.
  Gross, J.H. 2011. Mass Spectrometry, 2nd ed., Springer, Heidelberg.
  Gustafsdottir, S.M., Nordengrahn, A., Fredriksson, S., Wallgren, P., Rivera, E., Schallmeiner, E., Merza, M., and Landegren, U. 2006. Detection of individual microbial pathogens by proximity ligation. Clin. Chem. 52:1152‐1160.
  Higuchi, R., Fockler, C., Dollinger, G., and Watson, R. 1993. Kinetic PCR analysis: Real‐time monitoring of DNA amplification reactions. Biotechnology 11:1026‐1030.
  Hyndman, D.L. and Mitsuhashi, M. 2003. PCR primer design. Methods Mol. Biol. 226:81‐88.
  Kamali‐Moghaddam, M., Pettersson, F.E., Wu, D., Englund, H., Darmanis, S., Lord, A., Tavoosidana, G., Sehlin, D., Gustafsdottir, S., Nilsson, L.N., Lannfelt, L., and Landegren, U. 2010. Sensitive detection of Aβ protofibrils by proximity ligation—relevance for Alzheimer's disease. BMC Neurosci. 11:124.
  Korff, S., Katus, H.A., and Giannitsis, E. 2006. Differential diagnosis of elevated troponins. Heart 92:987‐993.
  Kuzyk, M.A., Smith, D., Yang, J., Cross, T.J., Jackson, A.M., Hardie, D.B., Anderson, N.L., and Borchers, C.H. 2009. Multiple reaction monitoring‐based, multiplexed, absolute quantitation of 45 proteins in human plasma. Mol. Cell Proteom. 8:1860‐1877.
  Landegren, U., Vanelid, J., Hammond, M., Nong, R.Y., Wu, D., Ulleras, E., and Kamali‐Moghaddam, M. 2012. Opportunities for sensitive plasma proteome analysis. Anal. Chem. 84:1824‐1830.
  Lange, P.H., Ercole, C.J., Lightner, D.J., Fraley, E.E., and Vessella, R. 1989. The value of serum prostate specific antigen determinations before and after radical prostatectomy. J. Urol. 141:873‐879.
  Lundberg, M., Eriksson, A., Tran, B., Assarsson, E., and Fredriksson, S. 2011. Homogeneous antibody‐based proximity extension assays provide sensitive and specific detection of low‐abundant proteins in human blood. Nucleic Acids Res. 39:e102.
  Martin, D.B., Gifford, D.R., Wright, M.E., Keller, A., Yi, E., Goodlett, D.R., Aebersold, R., and Nelson, P.S. 2004. Quantitative proteomic analysis of proteins released by neoplastic prostate epithelium. Cancer Res. 64:347‐355.
  Meza, M.B. 2000. Bead‐based HTS applications in drug discovery. Drug Disc. Today 1:28‐41.
  Nicol, G.R., Han, M., Kim, J., Birse, C.E., Brand, E., Nguyen, A., Mesri, M., FitzHugh, W., Kaminker, P., Moore, P.A., Ruben, S.M., and He, T. 2008. Use of an immunoaffinity‐mass spectrometry‐based approach for the quantification of protein biomarkers from serum samples of lung cancer patients. Mol. Cell Proteom. 7:1974‐1982.
  Rutledge, R.G. and Côté, C. 2003. Mathematics of quantitative kinetic PCR and the application of standard curves. Nucleic Acids Res. 31:e93.
  Schiess, R., Wollscheid, B., and Aebersold, R. 2009. Targeted proteomic strategy for clinical biomarker discovery. Mol. Oncol. 3:33‐44.
  Soderberg, O., Gullberg, M., Jarvius, M., Ridderstrale, K., Leuchowius, K.J., Jarvius, J., Wester, K., Hydbring, P., Bahram, F., Larsson, L.G., and Landegren, U. 2006. Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat. Methods 3:995‐1000.
  Tavoosidana, G., Ronquist, G., Darmanis, S., Yan, J., Carlsson, L., Wu, D., Conze, T., Ek, P., Semjonow, A., Eltze, E., Larsson, A., Landegren, U.D., and Kamali‐Moghaddam, M. 2011. Multiple recognition assay reveals prostasomes as promising plasma biomarkers for prostate cancer. Proc. Natl. Acad. Sci. U.S.A. 108:8809‐8814.
  Wide, L., Bennich, H., and Johansson, S.G. 1967. Diagnosis of allergy by an in‐vitro test for allergen antibodies. Lancet 2:1105‐1107.
  Yan, J., Horák, D., Lenfeld, J., Hammond, M., and Kamali‐Moghaddam, M. 2013. A tosyl‐activated magnetic bead cellulose as solid support for sensitive protein detection. J. Biotechnol. 167:235‐240.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library