ChIP‐chip for Genome‐Wide Analysis of Protein Binding in Mammalian Cells

Tae Hoon Kim1, Leah O. Barrera2, Bing Ren3

1 Yale University School of Medicine, New Haven, 2 University of California, San Diego, La Jolla, 3 Ludwig Institute for Cancer Research, La Jolla
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.13
DOI:  10.1002/0471142727.mb2113s79
Online Posting Date:  July, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

ChIP‐chip combines chromatin immunoprecipitation (ChIP) with microarrays (chip) to determine protein‐DNA interactions occurring in living cells. The high throughput nature of this method makes it an ideal approach for identifying transcription factor targets or chromatin modification sites along the genome. UNIT 21.9 describes a protocol for analysis of protein‐DNA interactions in yeast cells. This unit introduces an alternative protocol developed for mammalian cells. Curr. Protoc. Mol. Biol. 79:21.13.1‐21.13.22. © 2007 by John Wiley & Sons, Inc.

Keywords: ChIP‐chip; transcription factor; chromatin modifications; genome tiling microarrays; promoter arrays

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: ChIP‐Chip Analysis of Protein‐DNA Binding Sites
  • Basic Protocol 2: Analysis of PCR Array Data
  • Support Protocol 1: Preparation of Annealed Linkers
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: ChIP‐Chip Analysis of Protein‐DNA Binding Sites

  Materials
  • Mammalian cells (ATCC # CCL‐186)
  • MEM with Earle's salts (Invitrogen) supplemented with 10% FCS
  • PBS, pH 7.4 (Invitrogen or see recipe)
  • TE buffer, pH 8.0 ( appendix 22)
  • 5 M sodium chloride (NaCl)
  • 0.5 M EDTA, pH 8.0
  • 0.5 M EGTA, pH 8.0
  • 1 M HEPES, pH 8.0
  • 37% formaldehyde
  • 2.5 M glycine
  • Lysis buffer (see recipe)
  • Protein extraction buffer (see recipe)
  • Chromatin extraction buffer (see recipe)
  • Glycerol
  • Dynabeads coupled to appropriate secondary antibodies (Invitrogen)
  • 5 mg/ml BSA in PBS, prepared immediately before use with BSA powder (Sigma‐Aldrich)
  • Antibody directed against protein of interest (e.g., Upstate Biotechnology, Santa Cruz Biotech, Abcam)
  • Triton X‐100
  • 10% sodium deoxycholate (DOC) in distilled water, prepared immediately before use
  • 50× complete protease inhibitor solution, prepared immediately before use by dissolving one tablet (Roche Applied Science) in 1 ml dH 2O
  • RIPA buffer (see recipe)
  • Elution buffer (see recipe)
  • 20 mg/ml glycogen (Roche Applied Science)
  • 20 mg/ml proteinase K
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • Chloroform
  • 75% and 100% ethanol, cold and room temperature
  • 10 mg/ml RNase A (DNase‐free)
  • Qiagen QIAquick PCR purification kit (Qiagen)
  • 3 U/µl T4 DNA polymerase and 10× buffer (New England Biolabs)
  • 10 mg/ml BSA (acetylated, New England Biolabs)
  • 2.5 and 20 mM dNTP mixes (containing 2.5 or 20 mM each of dATP, dCTP, dGTP, and dTTP)
  • 3 M sodium acetate, pH 5.3
  • 400 U/µl T4 DNA ligase and 5× buffer (New England Biolabs)
  • Annealed linkers (see protocol 3)
  • 10× ThermoPol reaction buffer (NEB)
  • 40 mM oJW102 oligo (5′‐GCGGTGACCCGGGAGATCTGAATTC‐3′, HPLC‐purified)
  • 5 U/µl Taq polymerase (Qiagen)
  • 2.5 U/µl PfuUltra polymerase (Stratagene)
  • BioPrime array CGH genomic labeling system kit (Invitrogen) containing:
    • Exo‐Klenow fragment
    • 2.5× random primers solution
    • 10× dCTP nucleotide mix
    • 10× dUTP nucleotide mix
    • Control DNA (salmon sperm)
    • Stop buffer: 0.5 M EDTA, pH 8.0
  • Cy3‐dCTP and Cy5‐dCTP (GE Healthcare Biosciences)
  • Prehybridization solution (see recipe)
  • Reverse osmosis (RO) water
  • Cot‐1 DNA (Invitrogen)
  • 2.2× SSC ( appendix 22)/0.22% SDS, prepare within 1 hr of use
  • Hybridization buffer (see recipe)
  • 0.1× SSC
  • 37°C, 5% CO 2 humidified incubator
  • 500‐cm2 plates (Corning)
  • Cell scraper
  • 250‐ml conical bottles
  • Platform rocker
  • 15‐ and 50‐ml conical tubes
  • Branson 450 sonifier fitted with a microtip
  • Flourometer
  • Magnetic concentrator (Invitrogen)
  • 65°C incubator
  • 1.5‐ml microcentrifuge tubes
  • 12°, 37°, 42°, and 60°C water baths
  • UV spectrophotometer
  • 200‐µl PCR tubes
  • PCR thermal cycler
  • 100°C heating block
  • Coplin jars
  • Cap‐locks for microcentrifuge tubes
  • Tabletop centrifuge (e.g., Eppendorf 5804) with microplate rotor (A‐2‐DWP)
  • Hybridization chambers (Corning)
  • Slide racks
  • Glass staining dish (Wheaton)
  • Scanner (e.g., Axon 4000B)
  • Scanning software (e.g., GenePix)
NOTE: Use only molecular biology grade (DNase‐free) reagents and chemicals.

Basic Protocol 2: Analysis of PCR Array Data

  Materials
  • 40 mM oJW102 (5′‐GCGGTGACCCGGGAGATCTGAATTC‐3′, HPLC‐purified)
  • 40 mM oJW103 (5′‐GAATTCAGATC‐3′, HPLC‐purified)
  • 1 M Tris·Cl, pH 7.9 ( appendix 22)
  • 1.5‐ml microcentrifuge tubes
  • 70° and 95°C heating blocks
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Bolstad, B.M., Irizarry, R.A., Astrand, M., and Speed, T.P. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185‐193.
   Buck, M.J. and Lieb, J.D. 2004. ChIP‐chip: Considerations for the design, analysis, and application of genome‐wide chromatin immunoprecipitation experiments. Genomics 83:349‐360.
   Buck, M.J., Nobel, A.B., and Lieb, J.D. 2005. ChIPOTLE: A user‐friendly tool for the analysis of ChIP‐chip data. Genome Biol. 6:R97.
   Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. 1998. Cluster analysis and display of genome‐wide expression patterns. Proc. Natl. Acad. Sci. U.S.A. 95:14863‐14868.
   Gilmour, D.S. and Lis, J.T. 1985. In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster. Mol. Cell. Biol. 5:2009‐2018.
   Heintzman, N.D., Stuart, R.K., Hon, G., Fu, Y., Ching, C.W., Hawkins, R.D., Barrera, L.O., Van Calcar, S., Qu, C., Ching, K.A., Wang, W., Weng, Z., Green, R.D., Crawford, G.E., and Ren, B. 2007. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 39:311‐318.
   Hughes, T.R., Marton, M.J., Jones, A.R., Roberts, C.J., Stoughton, R., Armour, C.D., Bennett, H.A., Coffey, E., Dai, H., He, Y.D., Kidd, M.J., King, A.M., Meyer, M.R., Slade, D., Lum, P.Y., Stepaniants, S.B., Shoemaker, D.D., Gachotte, D., Chakraburtty, K., Simon, J., Bard, M., and Friend, S.H. 2000. Functional discovery via a compendium of expression profiles. Cell 102:109‐126.
   Isogai, Y., Takada, S., Tjian, R., and Keles, S. 2007. Novel TRF1/BRF target genes revealed by genome‐wide analysis of Drosophila Pol III transcription. EMBO J. 26:79‐89.
   Iyer, V.R., Horak, C.E., Scafe, C.S., Botstein, D., Snyder. M., and Brown, P.O. 2001. Genomic binding sites of the yeast cell‐cycle transcription factors SBF and MBF. Nature 409:533‐538.
   Ji, X., Li, W., Song, J., Wei, L., and Liu, X.S. 2006. CEAS: Cis‐regulatory element annotation system. Nucl. Acids Res. 34:W551‐W554.
   Johnson, W.E., Li, W., Meyer, C.A., Gottardo, R., Carroll, J.S., Brown, M., and Liu, X.S. 2006. Model‐based analysis of tiling‐arrays for ChIP‐chip. Proc. Natl. Acad. Sci. U.S.A. 103:12457‐12462.
   Karolchik, D., Baertsch, R., Diekhans, M., Furey, T.S., Hinrichs, A., Lu, Y.T., Roskin, K.M., Schwartz, M., Sugnet, C.W., Thomas, D.J., Weber, R.J., Haussler, D., and Kent, W.J. 2003. The UCSC Genome Browser Database. Nucl. Acids Res. 31:51‐54.
   Kim, T.H., Barrera, L.O., Zheng, M., Qu, C., Singer, M.A., Richmond, T.A., Wu, Y., Green, R.D., and Ren, B. 2005. A high‐resolution map of active promoters in the human genome. Nature 436:876‐880.
   Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J. 2005. Single‐nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol. 3:e328.
   Matys, V., Kel‐Margoulis, O.V., Fricke, E., Liebich, I., Land, S., Barre‐Dirrie, A., Reuter, I., Chekmenev, D., Krull, M., Hornischer, K., Voss, N., Stegmaier, P., Lewicki‐Potapov, B., Saxel, H., Kel, A.E., and Wingender, E. 2006. TRANSFAC and its module TRANSCompel: Transcriptional gene regulation in eukaryotes. Nucl. Acids Res. 34:D108‐D110.
   Orlando, V. and Paro, R. 1993. Mapping polycomb‐repressed domains in the bithorax complex using in vivo formaldehyde cross‐linked chromatin. Cell 75:1187‐1198.
   Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D.K., and Young, R.A. 2005. Genome‐wide map of nucleosome acetylation and methylation in yeast. Cell 122:517‐527.
   Qi, Y., Rolfe, A., MacIsaac, K.D., Gerber, G.K., Pokholok, D., Zeitlinger, J., Danford, T., Dowell, R.D., Fraenkel, E., Jaakkola, T.S., Young, R.A., and Gifford, D.K. 2006. High‐resolution computational models of genome binding events. Nat. Biotechnol. 24:963‐970.
   Ren, B., Robert, F., Wyrick, J.J., Aparicio, O., Jennings, E.G., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E., Volkert, T.L., Wilson, C.J., Bell, S.P., and Young, R.A. 2000. Genome‐wide location and function of DNA binding proteins. Science 290:2306‐2309.
   Sandelin, A., Alkema, W., Engstrom, P., Wasserman, W.W., and Lenhard, B. 2004. JASPAR: An open‐access database for eukaryotic transcription factor binding profiles. Nucl. Acids Res. 32:D91‐D94.
   Smyth, G.K. 2005. Limma: Linear models for microarray data. In Bioinformatics and Computational Biology Solutions Using R and Bioconductor (V.C.R. Gentleman, S. Dudoit, R. Irizarry, and W. Huber, eds.) pp. 397‐420. Springer, New York.
   Smyth, G.K. and Speed, T. 2003. Normalization of cDNA microarray data. Methods 31:265‐273.
   Solomon, M.J. and Varshavsky, A. 1985. Formaldehyde‐mediated DNA‐protein cross‐linking: A probe for in vivo chromatin structures. Proc. Natl. Acad. Sci. U.S.A. 82:6470‐6474.
   Wu, Z., Irizarry, R.A., Gentleman, R., Martinez‐Murillo, F., and Spencer, F. 2004. A model based background adjustment for oligonucleotide expression arrays. In Dept. of Biostatistics Working Papers. Johns Hopkins University, Baltimore, Maryland.
   Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., and Speed, T.P. 2002. Normalization for cDNA microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucl. Acids Res. 30:e15.
   Zheng, M., Barrera, L.O., Ren, B., and Wu, Y. 2005. ChIP‐chip: Data, model, and analysis. In Proceedings of the American Statistical Association, Statistical Computing Section. American Statistical Association, Alexandria, Virginia.
Internet Resources
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library