ChIP‐Seq: A Method for Global Identification of Regulatory Elements in the Genome

Debasish Raha1, Miyoung Hong1, Michael Snyder1

1 Stanford University, Stanford, California
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.19
DOI:  10.1002/0471142727.mb2119s91
Online Posting Date:  July, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes ChIP‐Seq methodology, which involves chromatin immunoprecipitation (ChIP) followed by high‐throughput sequencing (Seq), and enables the genome‐wide identification of binding sites of transcription factors (TFs) and other DNA‐binding proteins. The process is initiated by cross‐linking DNA and DNA‐bound proteins. Subsequently, chromatin is isolated from nuclei and subjected to sonication. An antibody against a specific TF or DNA‐binding protein is then used to immunoprecipitate specific DNA‐TF complexes. ChIP DNA is purified, sequencing adapters are ligated, and 30‐ to 35‐nucleotide (nt) sequence reads are generated. The sequence of the DNA fragments is mapped back to the reference genome for determination of the binding sites. Curr. Protoc. Mol. Biol. 91:21.19.1‐21.19.14. © 2010 by John Wiley & Sons, Inc.

Keywords: mammalian cells; ChIP; ChIP‐Seq; binding site; genome‐wide

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Preparation of ChIP DNA
  • Basic Protocol 2: Sequencing ChIP DNA Using Illumina Genome Analyzer
  • Support Protocol 1: Assess Quality of ChIP DNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of ChIP DNA

  Materials
  • Cells growing in appropriate growth medium (see appendix 3F)
  • 37% formaldehyde
  • 2 M glycine (see recipe)
  • 1× PBS with protease inhibitors: dissolve one Complete Protease Inhibitor tablet (Roche) in 22.5 ml ice‐cold water, add 2.5 ml 10× PBS ( appendix 22) and vortex to dissolve; keep on ice
  • Hypotonic buffer (see recipe), ice‐cold
  • 1× RIPA buffer (see recipe)
  • Antibody for immunoprecipitation
  • Protein A–Agarose, Fast Flow (Millipore)
  • Elution Buffer 1 (see recipe)
  • Elution Buffer 2 (see recipe)
  • TE buffer ( appendix 22)
  • 20 mg/ml proteinase K
  • RNase (Qiagen, cat. no. 19101)
  • QIAquick PCR purification kit (Qiagen) including QIAquick purification columns and elution buffer (Buffer EB)
  • Nuclease‐free water (for preparing reagents listed above)
  • 15‐ and 50‐ml conical tubes (Falcon)
  • Clay Adams Nutator mixer
  • 7‐ml Dounce homogenizer (Kontes Glass)
  • 2‐ml microcentrifuge tubes, prechilled
  • Probe sonicator: e.g., Branson 250 Sonifier
  • 65° and 45°C water baths
  • Additional reagents and equipment for basic cell culture techniques (including trypsinization; appendix 3F) and immunoprecipitation (unit 10.16)
NOTE: Use nuclease‐free water in all recipes and protocol steps.NOTE: Vary the volume of each reagent depending upon the number of ChIP DNAs in the experiment.NOTE: The tissue culture cells need to be maintained in appropriate medium and in growth conditions optimal for healthy cells. Grow cells in freshly prepared medium, change medium every 2 to 3 days to avoid overgrowth of cells, and plate cells at appropriate density when passaging cells. Also see appendix 3F.

Basic Protocol 2: Sequencing ChIP DNA Using Illumina Genome Analyzer

  Materials
  • ChIP DNA sample from step 26 of protocol 1
  • End‐It DNA End Repair Kit (Epicentre) containing:
    • 2.5 mM dNTP Mix
    • 10 mM ATP
    • End‐Repair Enzyme Mix
    • End‐Repair 10× Buffer
  • QIAquick PCR Purification Kit (Qiagen) including QIAquick columns and elution buffer (Buffer EB)
  • 100 mM dATP (New England Biolabs)
  • Klenow fragment of DNA polymerase I (3′→5′ exo minus; New England Biolabs, cat. no. M0212) and NEBuffer 2 (New England Biolabs)
  • LigaFast Ligase and 2× DNA ligase buffer (Promega)
  • Illumina Adapter Oligo Mix
  • QIAquick MinElute columns (Qiagen)
  • 2% agarose E‐gel (Invitrogen) with SYBR SAFE gel stain (also see unit 2.5 for general agarose gel electrophoresis protocols)
  • Qiagen Gel Extraction Kit
  • Illumina PCR Primers 1.1 and 2.1
  • 2× Phusion HF Master Mix (New England Biolabs, cat. no. F531)
  • Illumina Genome Analyzer with flowcells, reagents, and cluster station
  • Eland data collection software (Illumina)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
NOTE: Use nuclease‐free water in all recipes and protocol steps.

Support Protocol 1: Assess Quality of ChIP DNA

  Materials
  • Input DNA from step 26 of protocol 1
  • ChIP DNA prepared using TF‐specific antibody ( protocol 1)
  • ChIP DNA prepared using normal IgG ( protocol 1)
  • Taq Master Mix (Qiagen)
  • SYBR Mix for qPCR (Roche)
  • Control Pol II primers:
    • 1. (FWD) 5′GGAAAGAGTGGTGCGGTAGC‐3′
    • (RVS) 5′‐GGGATGTTCACCACCTGCTT‐3′
    • 2. (FWD) 5′‐CTGAGGGCCACGGAAGAAA‐3′
    • (RVS) 5′‐TGCGTGGAACAACGGTAGC‐3′
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5) or qPCR (unit 15.8)
NOTE: Use nuclease‐free water in all recipes and protocol steps.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Euskirchen, G.M., Rozowsky, J.S., Wie, C.L., Lee, W.H., Zhang, Z.D., Hartman, S., Emanuelsson, O., Stolc, V., Weissman, S., Gerstein, M.B., Ruan, Y., and Snyder, M. 2007. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array‐ and sequencing‐based technologies. Genome Res. 6:898‐909.
   The ENCODE Project Consortium. 2007. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447:799‐816.
   Gilmour, D.S. and Lis, J.T. 1984. Detecting protein‐DNA interactions in vivo: Distribution of RNA polymerase on specific bacterial genes. Proc. Natl. Acad. Sci. U.S.A. 81:4275‐4279.
   Iyer, V.R., Horak, C.E., Scafe, C.S., Botstein, D., Snyder, M., and Brown, P.O. 2001. Genomic binding sites of the yeast cell‐cycle transcription factors SBF and MBF. Nature 409:533‐538.
   Johnson, D.S., Mortazavi, A., Myers, R.M., and Wold, B. 2007. Genome‐wide mapping of in vivo protein‐DNA interactions, Science 316:1497‐1502.
   Jothi, R., Cuddapah, S., Barski, A., Cui, K., and Zhao, K. 2008. Genome‐wide identification of in vivo protein‐DNA binding sites from ChIP‐Seq data Nucleic Acids Res. 36:5221‐5231.
   Ren, B., Robert, F., Wyrick, J.J., Aparicio, O., Jennings, E.G., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E., Volkert, T.L., Wilson, C.J., Bell, S.P., and Young, R.A. 2000. Genome‐wide location and function of DNA binding proteins. Science 290:2306‐2309.
   Robertson, G., Hirst, M., Bainbridge, M., Bilenky, M., Zhao, Y., Zeng, T., Euskirchen, G., Bernier, B., Varhol, R., Delaney, A., Thiessen, N., Griffith, O.L., He, A., Marra, M., Snyder, M., and Jones, S. 2007. Genome‐wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat Methods 4:651‐657.
   Rozowsk, J., Euskirchen, G., Auerbach, R.K., Zhang, Z.D., Gibson, T., Bjornson, R., Carriero, N., Snyder, M., and Gerstein, M.B. 2009. PeakSeq enables systematic scoring of ChIP‐seq experiments relative to controls. Nat. Biotechnol. 27:66‐75.
   Tuteja, G., White, P., Schug, J., and Kaestner, K.H. 2009. Extracting transcription factor targets from ChIP‐Seq data. Nucleic Acids Res. 37:e113.
   Wacker, D.A. and Kim, T.H. 2009. From sextant to GPS: Twenty‐five years of mapping the genome with ChIP. J. Cell. Biochem. 107:6‐10.
   Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nussbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, S. 2008. Model‐based analysis of ChIP‐Seq (MACS). Genome Biol. 9:R137.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library