Single Nucleotide Analysis of Cytosine Methylation by Whole‐Genome Shotgun Bisulfite Sequencing

Michelle D. Johnson1, Michael Mueller1, Laurence Game2, Timothy J. Aitman2

1 National Heart & Lung Institute, Imperial College London, London, United Kingdom, 2 MRC Clinical Sciences Centre, Faculty of Medicine, Imperial College London, London, United Kingdom
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.23
DOI:  10.1002/0471142727.mb2123s99
Online Posting Date:  July, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Unlike other methods to assess methylation, whole‐genome shotgun bisulfite sequencing is used to generate quantitative genome‐wide methylation profiles at single‐nucleotide resolution. As described in this unit, this method allows for the quantitative measurement of methylation at each cytosine base by treatment of genomic DNA with sodium bisulfite followed by sequencing and alignment of the reads to a reference genome. Curr. Protoc. Mol. Biol. 99:21.23.1‐21.23.28. © 2012 by John Wiley & Sons, Inc.

Keywords: DNA methylation; bisulfite sequencing; second‐generation sequencing; methylation profiling; read mapping

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Whole‐Genome Shotgun Bisulfite Library Generation
  • Alternate Protocol 1: Genomic DNA Extraction from Fibrous Tissues
  • Basic Protocol 2: Whole‐Genome Shotgun Bisulfite Sequencing Data Generation
  • Basic Protocol 3: Mapping of Bisulfite Sequencing Reads and Generation of Methylation Profiles
  • Support Protocol 1: Software Installation
  • Support Protocol 2: Merging of Alignment BAM Files
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Whole‐Genome Shotgun Bisulfite Library Generation

  Materials
  • Tissue of interest
  • Liquid nitrogen
  • DNeasy Blood & Tissue kit (Qiagen)
  • Qubit dsDNA HS assay kit (Invitrogen)
  • Unmethylated lambda DNA (Promega)
  • Low‐TE buffer: 10 mM Tris⋅Cl, pH 8.0/0.1 mM EDTA (USB Corporation)
  • 2% E‐Gel EX (Invitrogen)
  • Quick‐Load 50 bp‐ladder (New England Biolabs)
  • QIAquick PCR purification kit (Qiagen)
  • NEBNext End Repair module (New England Biolabs)
  • DNase/RNase free H 2O
  • NEBNext dA‐Tailing module (New England Biolabs)
  • NEBNext Quick Ligation module (New England Biolabs)
  • 25 µM Illumina Early Access Methylation adapter oligos (Illumina)
  • Loading dye (see recipe)
  • 1× Tris‐Acetate‐EDTA (TAE) buffer ( appendix 22)
  • SYBR Gold nucleic acid gel stain (Invitrogen)
  • MinElute Gel Extraction kit (Qiagen)
  • Hi‐Di formamide (Applied Biosystems)
  • Zymo Research C‐T conversion reagent and M‐Dilution Buffer (Cambridge Bioscience)
  • 0.1 N sodium hydroxide (NaOH)
  • TE buffer (molecular‐biology grade; Sigma; also see recipe in appendix 22)
  • PfuTurbo C x Hotstart DNA polymerase and 10× PfuTurbo C x reaction buffer (Agilent)
  • 10 mM dNTP mix (Bioline)
  • HPLC purified library amplification primers, diluted to 25 µM:
  • Forward: 5′‐CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT‐3′
  • Reverse: 5′‐AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT‐3′
  • Library Quantification Kit/Illumina GA/Universal (Kapa Biosystems, cat. no. KK4824; http://www.kapabiosystems.com/)
  • EB buffer from either the QIAquick PCR purification kit or MinElute Gel Extraction kit, containing 0.1% (v/v) Tween 20
  • Cell crusher (Stratech, http://www.stratech.co.uk/)
  • Weighing balance
  • 2.0‐ml Safe‐Lock tubes (Eppendorf)
  • TissueLyserII (Qiagen)
  • 5‐mm stainless steel beads (Qiagen)
  • 56° and 50°C shaking heat blocks
  • 6 mm × 16 mm Covaris microtubes (KBiosciences; http://www.kbiosciences.co.uk)
  • Picofuge (optional)
  • Covaris System, S‐Series, model S2 (KBiosciences; http://www.kbiosciences.co.uk)
  • Thin‐walled PCR tubes
  • Qubit fluorimeter and assay tubes (Invitrogen)
  • Picofuge
  • E‐gel electrophoresis system (Invitrogen)
  • Gel documentation system
  • Thermal cycler
  • Dark Reader transilluminator (Clare Chemical Research)
  • Sterile scalpel
  • 1.5‐ and 2.0‐ml Lo‐Bind DNA tubes (Eppendorf)
  • Amicon Ultra 0.5‐ml, 10‐kDa Ultracel‐PL membrane columns (Millipore)
  • Agilent Bioanalzyer and High Sensitivity DNA chip (Agilent)
  • 1.5‐ml amber tubes
  • ABI 7500 Real time quantitative PCR machine (Applied Biosystems)
  • Real‐time qPCR 96‐well plates
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)

Alternate Protocol 1: Genomic DNA Extraction from Fibrous Tissues

  Materials
  • Whole‐genome bisulfite shotgun libraries ( protocol 1 or protocol 2)
  • Elution buffer (EB; from either the Qiaquick PCR purification kit or MinElute Gel Extraction kit)
  • 0.1 N NaOH
  • Illumina TruSeq paired‐end Cluster kit v3
  • Illumina TruSeq SBS kit v3
  • Illumina cBot
  • 8‐tube strips (Elkay, cat. no. THER‐08N, http://www.elkaylabs.com/)
  • Illumina HiSeq2000
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Aird, D., Ross, M.G., Chen, W.S., Danielsson, M., Fennell, T., Russ, C., Jaffe, D.B., Nusbaum, C., and Gnirke, A. 2011. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Biol. 12:R18.
   Atanur, S.S., Birol, I., Guryev, V., Hirst, M., Hummel, O., Morrissey, C., Behmoaras, J., Fernandez‐Suarez, X.M., Johnson, M.D., McLaren, W.M., Patone, G., Petretto, E., Plessy, C., Rockland, K.S., Rockland, C., Saar, K., Zhao, Y., Carninci, P., Flicek, P., Kurtz, T., Cuppen, E., Pravenec, M., Hubner, N., Jones, S.J., Birney, E., and Aitman, T.J. 2010. The genome sequence of the spontaneously hypertensive rat: Analysis and functional significance. Genome Res. 20:791‐803.
   Cokus, S.J., Feng, S., Zhang, X., Chen, Z., Merriman, B., Haudenschild, C.D., Pradhan, S., Nelson, S.F., Pellegrini, M., and Jacobsen, S.E. 2008. Shotgun bisulfite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 452:215‐219.
   Down, T.A., Rakyan, V.K., Turner, D.J., Flicek, P., Li, H., Kulesha, E., Gräf, S., Johnson, N., Herrero, J., Tomazou, E.M., Thorne, N.P., Bäckdahl, L., Herberth, M., Howe, K.L., Jackson, D.K., Miretti, M.M., Marioni, J.C., Birney, E., Hubbard, T.J., Durbin, R., Tavaré, S., and Beck, S. 2008. A Bayesian deconvolution strategy for immunoprecipitation‐based DNA methylome analysis. Nat. Biotechnol. 26:779‐785.
   Frommer, M., McDonald, L.E., Millar, D.S., Collis, C.M., Watt, F., Grigg, G.W., Molloy, P.L., and Paul, C.L. 1992. A genomic sequencing protocol that yields a positive display of 5‐methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. U.S.A. 89:1827‐1831.
   Hayatsu, H., Wataya, Y., Kai, K., and Iida, S. 1970. Reaction of sodium bisulfite with uracil, cytosine, and their derivatives. Biochemistry 9:2858‐2865.
   Laird, P.W. 2005. Cancer epigenetics. Hum. Mol. Genet. 14:R65‐R76.
   Laird, P.W. 2010. Principles and challenges of genomewide DNA methylation analysis. Nat. Rev. Genet. 11:191‐203.
   Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biol. 10:R25.
   Law, J.A. and Jacobsen, S.E. 2010. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat. Rev. Genet. 11:204‐220.
   Li, H. and Durbin, R. 2009. Fast and accurate short read alignment with Burrows‐Wheeler transform. Bioinformatics 25:1754‐1760.
   Lister, R., Pelizzola, M., Dowen, R.H., Hawkins, R.D., Hon, G., Tonti‐Filippini, J., Nery, J.R., Lee, L., Ye, Z., Ngo, Q.M., Edsall, L., Antosiewicz‐Bourget, J., Stewart, R., Ruotti, V., Millar, A.H., Thomson, J.A., Ren, B., and Ecker, J.R. 2009. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462:315‐322.
   Meissner, A., Mikkelsen, T.S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X., Bernstein, B.E., Nusbaum, C., Jaffe, D.B., Gnirke, A., Jaenisch, R., and Lander, E.S. 2008. Genome‐scale DNA methylation maps of pluripotent and differentiated cells. Nature 454:766‐770.
   Movassagh, M., Choy, M.K., Goddard, M., Bennett, M.R., Down, T.A., and Foo, R.S. 2010. Differential DNA methylation correlates with differential expression of angiogenic factors in human heart failure. PloS One 5:e8564.
   Reynard, L.N., Bui, C., Canty‐Laird, E.G., Young, D.A., and Loughlin, J. 2011. Expression of the osteoarthritis‐associated gene GDF5 is modulated epigenetically by DNA methylation. Hum. Mol. Genet. 20:3450‐3460.
   Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain‐terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463‐5467.
   Shapiro, R., Servis, R.E., and Welcher, M. 1970. Reactions of uracil and cytosine derivatives with sodium bisulfite. J. Am. Chem. Soc. 92:222‐224.
   Wang, J., Wang, W., Li, R., Li, Y., Tian, G., Goodman, L., Fan, W., Zhang, J., Li, J., Zhang, J., Guo, Y., Feng, B., Li, H., Lu, Y., Fang, X., Liang, H., Du, Z., Li, D., Zhao, Y., Hu, Y., Yang, Z., Zheng, H., Hellmann, I., Inouye, M., Pool, J., Yi, X., Zhao, J., Duan, J., Zhou, Y., Qin, J., Ma, L., Li, G., Yang, Z., Zhang, G., Yang, B., Yu, C., Liang, F., Li, W., Li, S., Li, D., Ni, P., Ruan, J., Li, Q., Zhu, H., Liu, D., Lu, Z., Li, N., Guo, G., Zhang, J., Ye, J., Fang, L., Hao, Q., Chen, Q., Liang, Y., Su, Y., San, A., Ping, C., Yang, S., Chen, F., Li, L., Zhou, K., Zheng, H., Ren, Y., Yang, L., Gao, Y., Yang, G., Li, Z., Feng, X., Kristiansen, K., Wong, G.K., Nielsen, R., Durbin, R., Bolund, L., Zhang, X., Li, S., Yang, H., and Wang, J. 2008. The diploid genome sequence of an Asian individual. Nature 456:60‐65.
   Wheeler, D.A., Srinivasan, M., Egholm, M., Shen, Y., Chen, L., McGuire, A., He, W., Chen, Y.J., Makhijani, V., Roth, G.T., Gomes, X., Tartaro, K., Niazi, F., Turcotte, C.L., Irzyk, G.P., Lupski, J.R., Chinault, C., Song, X.Z., Liu, Y., Yuan, Y., Nazareth, L., Qin, X., Muzny, D.M., Margulies, M., Weinstock, G.M., Gibbs, R.A., and Rothberg, J.M. 2008. The complete genome of an individual by massively parallel DNA sequencing. Nature 452:872‐876.
Key Reference
   Ranade, S.S., Chung, C.B., Zon, G., and Boyd, V.L. 2009. Preparation of genome‐wide DNA fragment libraries using bisulfite in polyacrylamide gel electrophoresis slices with formamide denaturation and quality control for massively parallel sequencing by oligonucleotide ligation and detection. Anal. Biochem. 390:126‐135.
  This article forms the basis for the in‐solution bisulfite conversion purification method.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library