ChIP‐exo Method for Identifying Genomic Location of DNA‐Binding Proteins with Near‐Single‐Nucleotide Accuracy

Ho Sung Rhee1, B. Franklin Pugh1

1 Pennsylvania State University, University Park, Pennsylvania
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.24
DOI:  10.1002/0471142727.mb2124s100
Online Posting Date:  October, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes the ChIP‐exo methodology, which combines chromatin immunoprecipitation (ChIP) with lambda exonuclease digestion followed by high‐throughput sequencing. ChIP‐exo allows identification of a nearly complete set of the binding locations of DNA‐binding proteins at near‐single‐nucleotide resolution with almost no background. The process is initiated by cross‐linking DNA and associated proteins. Chromatin is then isolated from nuclei and subjected to sonication. Subsequently, an antibody against the desired protein is used to immunoprecipitate specific DNA‐protein complexes. ChIP DNA is purified, sequencing adaptors are ligated, and the adaptor‐ligated DNA is then digested by lambda exonuclease, generating 25‐ to 50‐nucleotide fragments for high‐throughput sequencing. The sequences of the fragments are mapped back to the reference genome to determine the binding locations. The 5′ ends of DNA fragments on the forward and reverse strands indicate the left and right boundaries of the DNA‐protein binding regions, respectively. Curr. Protoc. Mol. Biol. 100:21.24.1‐21.24.14. © 2012 by John Wiley & Sons, Inc.

Keywords: ChIP; ChIP‐exo; binding location; genome‐wide; lambda exonuclease

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Identification of Protein‐DNA Binding Sites in Saccharomyces cerevisiae by ChIP‐exo
  • Alternate Protocol 1: Identification of Protein‐DNA Binding Sites in Mammalian Cells by ChIP‐exo
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identification of Protein‐DNA Binding Sites in Saccharomyces cerevisiae by ChIP‐exo

  Materials
  • Yeast culture
  • 37% (w/v) formaldehyde
  • 2.5 M glycine
  • ST buffer (see recipe)
  • Protease inhibitor cocktail tablets (Roche)
  • FA lysis buffer (see recipe)
  • 20% (v/v) SDS
  • Antibody against protein of interest
  • Protein A− or G−Sepharose beads or equivalent (e.g., magnetic beads)
  • FA wash buffers 1, 2, and 3 (see reciperecipes)
  • TE buffer ( appendix 22)
  • 10 mM Tris‐Cl, pH 7.5, 8.0, and 9.2 ( appendix 22)
  • NEBuffer 2 (New England BioLabs)
  • 10× BSA (1 mg/ml)
  • 3 and 25 mM dNTPs
  • 3 mM dATP
  • Oligonucleotides for library construction (see Table 21.24.1)
  • 3 U/µl T4 DNA polymerase (New England BioLabs)
  • 10 U/µl T4 polynucleotide kinase with 10× buffer (New England BioLabs)
  • 5 U/µl Klenow fragment (3′→5′ exo, New England BioLabs)
  • 500 U/µl T4 DNA ligase with 10× buffer (New England BioLabs)
  • 10 U/µl phi29 DNA polymerase with 10× buffer (New England BioLabs)
  • 5 U/µl lambda exonuclease with 10× buffer (New England BioLabs)
  • 30 U/µl RecJ f exonuclease (New England BioLabs)
  • ChIP elution buffer (see recipe)
  • 20 µg/µl protease K (Roche)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (Sigma)
  • 70%, 75%, and 100% (v/v) ethanol
  • 20 mg/ml glycogen (Roche)
  • AMPure magnetic beads (Agencourt)
  • 5 U/µl Taq DNA polymerase with 10× buffer (New England BioLabs)
  • Shaking incubator (e.g., I‐26R Incubator Shaker, New Brunswick)
  • 200‐ml centrifuge bottle with sealing cap (Nalgene)
  • RC6+ centrifuge with F10S‐6X500Y rotor (Sorvall) or equivalent
  • 2.0‐ml conical tube, natural (USA Scientific)
  • Filtered pipet tips
  • 0.5‐mm zirconium silicate beads (Next Advance)
  • Mini‐Beadbeater‐96 (BioSpec)
  • 22‐G, 1.5‐inch needle (Becton Dickinson)
  • 13 × 100−mm borosilicate glass culture tube
  • Centrifuge 5810R with A‐4‐81 swinging‐bucket rotor (Eppendorf) or equivalent
  • 1.5‐ml microcentrifuge tubes
  • Microcentrifuge(s) (e.g., models 5415R, 5424, and 5424R, Eppendorf)
  • 15‐ml conical polystyrene and polypropylene tubes
  • Bioruptor Standard (Diagenode)
  • Rotating wheel
  • Thermomixer Comfort 5355R, for 1.5‐ml tubes (Eppendorf)
  • 65°C heating block
  • Vacufuge Plus vacuum concentrator (Eppendorf)
  • 0.5‐ml PCR tubes (Eppendorf)
  • Thermal cycler (e.g., DNA Engine Thermal Cycler PTC‐200, Bio‐Rad)
  • DynaMag magnet (Invitrogen)
NOTE: Substitutes may be used for the indicated suppliers. Specific centrifuges and rotors are listed for convenience, but any centrifuge that uses similar‐sized bottles and reaches the same g force can be used. The authors use a DNA Engine Thermal Cycler PTC‐200, but any similar cycler should also work.
Table 1.4.1   MaterialsOligonucleotides for Library Construction

Oligonucleotide Supplier Sequence
For Applied Biosystems SOLiD System 5500 Series
P1‐T Adaptor (15 µM) Life Technologies 5′‐CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT‐3′ (41 bp)
5′‐TCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGCC‐3′ (42 bp)
P2‐T Adaptor (15 µM) Life Technologies 5′‐CGCCTTGGCCGTACAGCAGCCTCTTACACAGAGAATGAGGAACCCGGGGCAGTT‐3′ (55 bp)
5′‐CTGCCCCGGGTTCCTCATTCTCTGTGTAAGAGGCTGCTGTACGGCCAAGGCGT‐3′ (53 bp)
Library PCR Primer 1 (20 µM) Life Technologies 5′‐CCACTACGCCTCCGCTTTCCTCTCTATG‐3′ (28 bp)
Library PCR Primer 2 (20 µM) Life Technologies 5′‐CTGCCCCGGGTTCCTCATTCT‐3′ (21 bp)
For Applied Biosystems SOLiD System 2.0
P1 Adaptor (15 µM) Life Technologies 5′‐CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT‐3′ (41 bp)
5′‐ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGCC‐3′ (43 bp)
P2 Adaptor (15 µM) Life Technologies 5′‐AGAGAATGAGGAACCCGGGGCAGTT‐3′ (25 bp)
5′‐CTGCCCCGGGTTCCTCATTCTCT‐3′ (23 bp)
Library PCR Primer 1 (20 µM) Life Technologies 5′‐CCACTACGCCTCCGCTTTCCTCTCTATG‐3′ (28 bp)
Library PCR Primer 2 (20 µM) Life Technologies 5′‐CTGCCCCGGGTTCCTCATTCT‐3′ (21 bp)
For Illumina instruments a
TruSeq Adaptor, Index 1, first ligation b Illumina 5′‐GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG‐3′ (63 bp)
TruSeq Universal Adaptor, second ligation c Illumina 5′‐AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT‐3′ (58 bp)

 aNot tested with this protocol.
 bAlso requires reverse complement oligo with 3′ T overhang. Index 1 underlined.
 cAlso requires reverse complement oligo lacking 5′‐A.

Alternate Protocol 1: Identification of Protein‐DNA Binding Sites in Mammalian Cells by ChIP‐exo

  • Cross‐linked, sonicated DNA from mammalian cell culture (unit 21.19)
  • IP buffer
  • Mixed micelle buffer (see recipe)
  • High‐salt buffer (see recipe)
  • Detergent buffer (see recipe)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Dai, S.M., Chen, H.H., Chang, C., Riggs, S.D., and Flanagan, S.D. 2000. Ligation‐mediated PCR for quantitative in vivo footprinting. Nat. Biotechnol. 18:1108‐1111.
   Lee, T.I., Rinaldi, N.J., Robert, F., Odom, D.T., Bar‐Joseph, Z., Gerber, G.K., Hannett, N.M., Harbison, C.T., Thompson, C.M., Simon, I., Zeitlinger, J., Jennings, E.G., Murray, H.L., Gordon, D.B., Ren, B., Wyrick, J.J., Tagne, J.B., Volkert, T.L., Fraenkel, E., Gifford, D.K., and Young, R.A. 2002. Transcriptional regulatory networks in Saccharomyces cerevisiae. Science 298:799‐804.
   Little, J.W. 1981. Lambda exonuclease. Gene Amplif. Anal. 2:135‐145.
   Lovett, S.T. and Kolodner, R.D. 1989. Identification and purification of a single‐stranded‐DNA‐specific exonuclease encoded by the recJ gene of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 86:2627‐2631.
   Peng, S., Alekseyenko, A.A., Larschan, E., Kuroda, M.I., and Park, P.J. 2007. Normalization and experimental design for ChIP‐chip data. BMC Bioinformatics 8:219.
   Ptashne, M. and Gann, A. 1997. Transcriptional activation by recruitment. Nature 386:569‐577.
   Rhee, H.S. and Pugh, B.F. 2011. Comprehensive genome‐wide protein‐DNA interactions detected at single‐nucleotide resolution. Cell 147:1408‐1419.
   Rhee, H.S. and Pugh, B.F. 2012. Genome‐wide structure and organization of eukaryotic pre‐initiation complexes. Nature 483:295‐301.
   Rozowsky, J., Euskirchen, G., Auerbach, R.K., Zhang, Z.D., Gibson, T., Bjornson, R., Carriero, N., Snyder, M., and Gerstein, M.B. 2009. PeakSeq enables systematic scoring of ChIP‐seq experiments relative to controls. Nat. Biotechnol. 27:66‐75.
   Rychlik, W., Spencer, W.J., and Rhoads, R.E. 1990. Optimization of the annealing temperature for DNA amplification in vitro. Nucl. Acids Res. 18:6409‐6412.
   Struhl, K. 1995. Yeast transcriptional regulatory mechanisms. Annu. Rev. Genet. 29:651‐674.
   Tuteja, G., White, P., Schug, J., and Kaestner, K.H. 2009. Extracting transcription factor targets from ChIP‐Seq data. Nucleic Acids Res. 37:e113.
Key Reference
   Rhee and Pugh, 2011. See above.
  First description of ChIP‐exo method for various transcription factors in species ranging from yeast to human. This paper shows the proof of principle of ChIP‐exo, identifying a nearly complete set of genomic binding sites at near‐single‐nucleotide resolution.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library