BioTAP‐XL: Cross‐linking/Tandem Affinity Purification to Study DNA Targets, RNA, and Protein Components of Chromatin‐Associated Complexes

Artyom A. Alekseyenko1, Kyle A. McElroy2, Hyuckjoon Kang1, Barry M. Zee1, Peter V. Kharchenko3, Mitzi I. Kuroda1

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, 2 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, 3 Hematology/Oncology Program, Children's Hospital, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.30
DOI:  10.1002/0471142727.mb2130s109
Online Posting Date:  January, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In order to understand how chromatin complexes function in the nucleus, it is important to obtain a comprehensive picture of their protein, DNA, and RNA components, as well as their mutual interactions. This unit presents a chromatin cross‐linking approach (BioTAP‐XL) that utilizes a special BioTAP‐tagged transgenic protein bait along with mass spectrometry to identify protein complex components, and high‐throughput sequencing to identify RNA components and DNA binding sites. Full protocols are provided for Drosophila cells and for human cells in culture, along with an additional protocol for Drosophila embryos as the source material. A key element of the approach in all cases is the generation of control data from input chromatin samples. © 2015 by John Wiley & Sons, Inc.

Keywords: chromatin; formaldehyde cross‐linking; LC‐MS/MS; next‐generation sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: BioTAP‐XL for Drosophila and Human Cell Culture
  • Alternate Protocol 1: BioTAP‐XL from Drosophila Embryos as Starting Material
  • Alternate Protocol 2: RNA Pull‐Down Sample Recovery by Using On‐Bead Ligation and Library Preparation for Solexa/Illumina RNA‐seq
  • Support Protocol 1: Peptide Recovery from Input Chromatin
  • Support Protocol 2: DNA/RNA Recovery from Input Chromatin
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: BioTAP‐XL for Drosophila and Human Cell Culture

  Materials
  • BioTAP‐tagged protein‐expressing cultured cells:
  •  1–2 × 1010 for S2 cells
  •  1.5–3 × 109 for human cell lines (e.g., 293 T‐REx cells)
  • Culture medium for 293 T‐REx cells (see recipe)
  • 0.25% (1×) trypsin‐EDTA, with phenol red (Invitrogen, cat. no. 25200056)
  • Dulbecco's Modified Eagle Medium (DMEM; Invitrogen, cat. no. 11965)
  • Fetal bovine serum, heat‐inactivated (FBS; HyClone, Thermo Scientific, cat. no. SH30396.03)
  • Dulbecco's phosphate‐buffered saline without Ca and Mg (CMF‐DPBS; Thermo Scientific, cat. no. SH300028.02)
  • Phosphate‐buffered saline (PBS), pH 7.4 (Boston BioProducts, cat. no. BM‐220)
  • Culture medium for S2 cells (see recipe)
  • HyClone CCM3 serum‐free medium (Thermo Scientific, cat. no.SH30065)
  • Nuclear extraction buffer (NEB; see recipe)
  • Phenylmethylsulfonyl fluoride (PMSF; Sigma, cat. no. 78830‐5G)
  • 37% (w/v) formaldehyde (Fisher Scientific, cat. no. BP531‐500)
  • NSucrose buffer (see recipe)
  • NGlycerol buffer (see recipe)
  • Protease inhibitor cocktail tablets (Roche, cat. no. 11873580001)
  • Liquid nitrogen
  • TE buffer (see recipe)
  • 10% (w/v) sodium dodecyl sulfate solution (SDS; Sigma, cat. no. L4522‐100ML)
  • 10% (v/v) Triton X‐100 (Roche, cat. no.10789704001)
  • 5 M NaCl solution (Boston BioProducts, cat. no. BM‐244)
  • IgG agarose beads (Sigma, cat. no. A2909)
  • RIPA buffer (see recipe)
  • TEN 140 buffer (see recipe)
  • IgG elution buffer (see recipe) with and without SDS
  • Streptavidin–agarose beads (Thermo Scientific, cat. no. 20349)
  • 50 mM ammonium bicarbonate (Fluka, cat. no. 40867‐50G‐F)
  • Reverse cross‐linking buffer (see recipe)
  • Formic acid (Optima LC/MS; Fisher Scientific, cat. no. A117‐10X1AMP)
  • 0.5 μg/μl trypsin, sequencing grade (Promega, cat. no. V5111)
  • Pierce Acetonitrile (LC‐MS grade; Thermo Scientific, cat. no. 51101)
  • Trifluoroacetic acid (TFA; Optima LC/MS; Fisher Scientific, cat. no. A116‐10X1AMP)
  • UltraPure distilled water, RNase‐ and DNase‐free (Invitrogen, cat. no.10977‐015)
  • HPLC Buffer A (see recipe)
  • HPLC Buffer B (see recipe)
  • Trypsin‐digested BSA MS standard (New England Biolabs, cat. no. P8108S; optional)
  • 20 mg/ml proteinase K (Roche, cat. no. 03115879001)
  • 25:24:1 (v/v/v) UltraPure phenol/chloroform/isoamyl alcohol (Invitrogen, cat. no. 15593‐031)
  • 24:1 (v/v) chloroform/isoamyl alcohol (Sigma, cat. no. C0549)
  • 3 M sodium acetate, pH 5.5 (Applied Biosystems, cat. no. AM9740)
  • Ethanol, 200 proof (absolute ethanol; Sigma, cat. no. E7023‐500ML)
  • Phase Lock Gel, Heavy, 2‐ml tubes (5Prime, cat. no. 2302830; optional)
  • 5 mg/ml glycogen (Applied Biosystems, cat. no. AM9510)
  • 70% ethanol (diluted from 95% ethanol), ice cold
  • 75% ethanol (diluted from 95% ethanol), ice cold
  • 2 U/μl SUPERase•In (20 U/μl) RNase Inhibitor (Invitrogen, cat. no. AM2694)
  • 2 U/μl TURBO DNase and 10× TURBO DNase buffer (Invitrogen, cat. no. AM2238)
  • Quant‐iT PicoGreen dsDNA Assay Kit (Invitrogen, cat. no. P11496)
  • Quant‐iT RiboGreen RNA Assay Kit (Invitrogen, cat. no. R11490)
  • Additional materials for DNA and RNA high‐throughput sequencing methods:
    • NEBNext ChIP‐Seq Library Prep Master Mix Set for Illumina (New England BioLabs, cat. no. E6240S)
    • NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, cat. no. E7420S)
  • 150‐mm cell culture dishes (Corning, cat. no.430597)
  • 250‐ml conical centrifuge tubes (Corning, cat. no. 430776)
  • Swinging‐bucket centrifuge with variable temperature (Beckman J6‐MI with JS‐4.2 rotor)
  • 225‐cm2 T‐flasks with phenolic‐style cap (Corning, cat. no. 3000)
  • 2.8‐liter Fernbach glass flasks (Bellco Glass Inc., cat. no. 2552‐02800)
  • Multitron II ATR Shaker with cooling (INFORS‐HT)
  • 40‐ or 100‐ml Dounce homogenizer, with both A and B pestles (Bellco Glass Inc., cat. no. 1984‐10040 or 1984‐10100)
  • Orbital shaker: Gyrotory Shaker Model G2 (Brunswick Scientific)
  • 15‐ and 50‐ml conical centrifuge tubes (e.g., BD Falcon)
  • RotoFlex end‐over‐end rotator (Denville Scientific, cat. no. H5700)
  • Sonicator (Misonix Sonicator 3000 equipped with microtip)
  • 10K Amicon Ultra‐15 centrifugal filters (Millipore, cat. no. UFC901008)
  • 1.7‐ml Maxymum Recovery microcentrifuge tubes (Axygen, cat. no. 311‐05‐051)
  • 37°, 65°C and boiling water baths
  • SpeedVac evaporator
  • Pierce C18 Spin Tips (Thermo Scientific, cat. no. 84850)
  • Liquid chromatography–tandem mass spectrometry (LC‐MS/MS) apparatus (also see unit 10.22):
    • Agilent 1200 Binary HPLC Pump (Agilent Technologies)
    • Velos Pro Ion Trap Mass Spectrometer (Thermo Scientific)
  • Autosampler vial (Fisher Scientific, cat. no. 05‐704‐225)
  • Bath sonicator
  • HPLC column packed with Magic C18AQ 3‐μm resin (Michrom from New Objective)
  • NanoDrop ND‐3300 microspectrophotometer ( appendix 3J)
  • Additional reagents and equipment for western blotting (immunoblotting; unit 10.8), mass spectrometry (unit 10.22), and microvolume quantitation of nucleic acids using NanoDrop spectrophotometer ( appendix 3J)
CAUTION: Formaldehyde, phenol/chloroform/isoamyl alcohol, chloroform isoamyl alcohol, formic acid, and trifluoroacetic acid (TFA) are potentially hazardous reagents. See appendix 1H for appropriate precautions.

Alternate Protocol 1: BioTAP‐XL from Drosophila Embryos as Starting Material

  Additional Materials (also see protocol 1Basic Protocol)
  • BioTAP transgenic flies (see Strategic Planning)
  • Molasses agar plates (see recipe)
  • Embryo wash solution (see recipe)
  • Sodium hypochlorite (Sigma Aldrich, cat. no. 239305)
  • Embryo Collection Cage (Flystuff, cat. no. 59‐101 )
  • 425‐μm metal sieve (W.S. Tyler, cat. no..40)
  • 106‐μm metal sieve (W.S. Tyler, cat. no. 140)
  • Paint brush, 13 mm (0.5 in.) (Winsor & Newton, cat. no. 094376864021)
  • 100‐μm nylon woven net filter (Fisher Scientific, cat. no. NY1H00010)
  • Weigh boats
  • Balance
  • 120 Vac Overhead Stirrer (Wheaton, cat. no. 903475)
  • Potter‐ELV tissue grinder, 55‐ml mortar (Wheaton, cat. no. 358048)
  • Potter‐ELV tissue grinder, 55‐ml Teflon pestle (Wheaton, cat. no. 358051)
  • Büchner funnel (Fisher, cat. no. FB‐966‐H)
  • Side‐arm filtering flask (Fisher, cat. no. 10‐181E)
  • Miracloth (Calbiochem, cat. no. 475855)

Alternate Protocol 2: RNA Pull‐Down Sample Recovery by Using On‐Bead Ligation and Library Preparation for Solexa/Illumina RNA‐seq

  Additional Materials (also see protocol 1Basic Protocol)
  • CRAC‐TN150 buffer (see recipe)
  • RNace‐It Ribonuclease Cocktail 6000U (Agilent Technologies, cat. no. 400720)
  • CRAC‐Wash buffer 1 (see recipe)
  • 1 × CRAC‐PNK buffer (see recipe)
  • 5 × CRAC‐PNK buffer (see recipe)
  • 1 U/μl TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910)
  • RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515)
  • 3′‐BioTAP‐Solexa linker‐
  • /5rApp/rUrCrGrUrArUrGrCrCrGrUrCrUrUrCrUrGrCrUrUrGrUr/ddC/
  • [this RNA oligo has a blocked 3′ (ddC) end and an activated adenosine at the 5′ end, and may be ordered from Bioo Scientific]
  • 200 U/μl T4 RNA ligase 2 truncated K227Q and 50% PEG 8000 (New England Biolabs, cat. no. M0351L)
  • 100 mM ATP (adenosine 5′‐triphosphate) solution (GE Healthcare Life Sciences, cat. no. 27‐2056‐01)
  • 10 U/μl T4 polynucleotide kinase (T4 PNK) from T4‐infected Escherichia coli (Sigma, cat. no. P4390‐500UN)
  • 5′‐BioTAP‐Solexa linker‐
  • InvddT/GrGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC
  • (this DNA‐RNA hybrid oligo has an inverted ddT at the 5′ end to block multimerization of the oligo during the ligation reactions, and may be ordered from IDT)
  • 10 U/μl T4 RNA Ligase 1 (New England BioLabs, cat. no. M0204L)
  • SuperScript III First‐Strand Synthesis kit (Invitrogen, cat. no. 18080‐051)
  • 5× Phusion HF buffer (New England Biolabs)
  • CRAC‐RT primer: 5′‐CAAGCAGAAGACGGCATAC‐3′
  • CRAC‐forward primer: 5′‐AATGATACTGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA‐3′.
  • CRAC ‐reverse primer: 5′‐CAAGCAGAAGACGGCATACGA‐3′
  • 10 mM dNTP Mix (Invitrogen, cat. no. 18427‐088)
  • 2 U/μl Phusion Hot Start II DNA Polymerase (Thermo Scientific, cat. no. F‐549S)
  • TruSeq ChIP Sample Prep Kit for ChIP‐Seq (Illumina, cat. no. IP‐202‐1012)

Support Protocol 1: Peptide Recovery from Input Chromatin

  Additional Materials (also see protocol 1Basic Protocol)
  • 0.5‐ml aliquot of the sheared chromatin (from protocol 1Basic Protocol, step 44)
  • Pierce Detergent Removal Spin Columns, 2 ml (Thermo Scientific, cat. no. 87778)
  • Quick Start Bradford Protein Assay Kit 1 (Bio‐Rad, cat. no. 500‐0201EDU)

Support Protocol 2: DNA/RNA Recovery from Input Chromatin

  Additional Materials (See also protocol 1Basic Protocol)
  • 0.5‐ml aliquot of the sheared chromatin (from protocol 1Basic Protocol, step 44)
  • NanoDrop ND‐1000
  • 10× CutSmart Buffer (New England BioLabs, cat. no. B7204S)
  • 10 mg/ml DNase‐free RNaseA (Roche, cat. no. 11579681001)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Alekseyenko, A.A., Gorchakov, A.A., Kharchenko, P.V., and Kuroda, M.I. 2014a. Reciprocal interactions of human C10orf12 and C17orf96 with PRC2 revealed by BioTAP‐XL cross‐linking and affinity purification. Proc. Natl. Acad. Sci. U.S.A. 111:2488‐2493.
  Alekseyenko, A.A., Gorchakov, A.A., Zee, B.M., Fuchs, S.M., Kharchenko, P.V., and Kuroda, M.I. 2014b. Heterochromatin‐associated interactions of Drosophila HP1a with dADD1, HIPP1, and repetitive RNAs. Genes Dev. 28:1445‐1460.
  Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., Kluger, Y., and Reinberg, D. 2012. PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family complexes. Mol. Cell 45:344‐356.
  Granneman, S., Kudla, G., Petfalski, E., and Tollervey, D. 2009. Identification of protein binding sites on U3 snoRNA and pre‐rRNA by UV cross‐linking and high‐throughput analysis of cDNAs. Proc. Natl. Acad. Sci. U.S.A. 106:9613‐9618.
  Guerrero, C., Tagwerker, C., Kaiser, P., and Huang, L. 2006. An integrated mass spectrometry‐based proteomic approach: Quantitative analysis of tandem affinity‐purified in vivo cross‐linked protein complexes (QTAX) to decipher the 26 S proteasome‐interacting network. Mol. Cell Proteom. 5:366‐378.
  Lambert, J.P., Mitchell, L., Rudner, A., Baetz, K., and Figeys, D. 2009. A novel proteomics approach for the discovery of chromatin‐associated protein networks. Mol. Cell Proteom. 8: 870‐882.
  Lambert, J.P., Fillingham, J., Siahbazi, M., Greenblatt, J., Baetz, K., and Figeys, D. 2010. Defining the budding yeast chromatin‐associated interactome. Mol. Syst. Biol. 6:448.
  Mohammed, H., D'Santos, C., Serandour, A.A., Ali, H.R., Brown, G.D., Atkins, A., Rueda, O.M., Holmes, K.A., Theodorou, V., Robinson, J.L., Zwart, W., Saadi, A., Ross‐Innes, C.S., Chin, S.F., Menon, S., Stingl, J., Palmieri, C., Caldas, C., and Carroll, J.S. 2013. Endogenous purification reveals GREB1 as a key estrogen receptor regulatory factor. Cell Rep. 3:342‐349.
  Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. 1999. A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17:1030‐1032.
  Smart, S.K., Mackintosh, S.G., Edmondson, R.D., Taverna, S.D., and Tackett, A.J. 2009. Mapping the local protein interactome of the NuA3 histone acetyltransferase. Protein Sci. 18:1987‐1997.
  Tagwerker, C., Flick, K., Cui, M., Guerrero, C., Dou, Y., Auer, B., Baldi, P., Huang, L., and Kaiser, P. 2006. A tandem affinity tag for two‐step purification under fully denaturing conditions: Application in ubiquitin profiling and protein complex identification combined with in vivo cross‐linking. Mol. Cell Proteom. 5:737‐748.
  Tardiff, D.F., Abruzzi, K.C., and Rosbash, M. 2007. Protein characterization of Saccharomyces cerevisiae RNA polymerase II after in vivo cross‐linking. Proc. Natl. Acad. Sci. U.S.A. 104:19948‐19953.
  Venken, K.J., He, Y., Hoskins, R.A., and Bellen, H.J. 2006. P[acman]: A BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314:1747‐1751.
  Wang, C.I., Alekseyenko, A.A., LeRoy, G., Elia, A.E., Gorchakov, A.A., Britton, L.M., Elledge, S.J., Kharchenko, P.V., Garcia, B.A., and Kuroda, M.I. 2013. Chromatin proteins captured by ChIP‐mass spectrometry are linked to dosage compensation in Drosophila. Nat. Struct. Mol. Biol. 20:202‐209.
Internet Resources
  http://pklab.med.harvard.edu/mass.spec/viewms.html
  For an example of a more statistically rigorous evaluation of enrichment of BioTAP‐XL pull‐downs, see the Bamse method provided at the URL above. Briefly, this approach employs statistical methods that control for multiple sources of bias, including biological replicate variability (immunoprecipitations and inputs), differential base‐level abundance of proteins in different cell types (inputs), variability in peptide ionization or detection rates (technical), and nonspecific effects of pull‐down procedures.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library