Mapping Regulatory Factors by Immunoprecipitation from Native Chromatin

Guillermo A. Orsi1, Sivakanthan Kasinathan1, Gabriel E. Zentner2, Steven Henikoff3, Kami Ahmad4

1 These authors contributed equally to this work, 2 Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington, 3 Howard Hughes Medical Institute, Seattle, Washington, 4 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 21.31
DOI:  10.1002/0471142727.mb2131s110
Online Posting Date:  April, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Occupied Regions of Genomes from Affinity‐purified Naturally Isolated Chromatin (ORGANIC) is a high‐resolution method that can be used to quantitatively map protein‐DNA interactions with high specificity and sensitivity. This method uses micrococcal nuclease (MNase) digestion of chromatin and low‐salt solubilization to preserve protein‐DNA complexes, followed by immunoprecipitation and paired‐end sequencing for genome‐wide mapping of binding sites. In this unit, we describe methods for isolation of nuclei and MNase digestion of unfixed chromatin, immunoprecipitation of protein‐DNA complexes, and high‐throughput sequencing to map sites of bound factors. © 2015 by John Wiley & Sons, Inc.

Keywords: chromatin; transcription factor; MNase‐seq; transcription; ORGANIC

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Native Chromatin Immunoprecipitation of Transcription Factors in S. cerevisiae
  • Basic Protocol 2: Native Chromatin Immunoprecipitation of Transcription Factors in Drosophila Cultured Cells
  • Basic Protocol 3: Library Preparation for Paired‐End Illumina Sequencing
  • Support Protocol 1: Size Selection of Immunoprecipitated DNA Fragments
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Native Chromatin Immunoprecipitation of Transcription Factors in S. cerevisiae

  Materials
  • Phosphate‐buffered saline (PBS; see recipe) containing 0.5% bovine serum albumin (BSA)
  • Anti‐FLAG M2 magnetic beads (Sigma‐Aldrich, cat. no. A2220)
  • Saccharomyces cerevisiae growing in culture
  • YPD culture medium
  • Resuspension buffer (see recipe)
  • Zymolyase (100 T equivalent, ZymoResearch, cat. no E1004)
  • SPC buffer (see recipe) with and without protease inhibitors, cold
  • Ficoll buffer (see recipe), cold
  • Liquid N 2
  • 1 M CaCl 2 (see recipe)
  • Sigma MNase (prepare 1 U MNase/5 μl nuclease free water; see recipe for 1 U/μl stock)
  • 0.5 M EDTA, pH 8.0 (see recipe)
  • 80 mM, 150 mM, or 600 mM NaCl extraction buffer (see recipe)
  • 5 M NaCl (see recipe)
  • 10% (v/v) Triton X‐100
  • IP wash buffer (see recipe)
  • 250 U/μl Benzonase (Sigma, cat. no. E1014)
  • 10 mg/ml RNase A (Thermo Scientific, cat. no. EN0531)
  • 10% (w/v) sodium dodecyl sulfate (SDS)
  • 20 mg/ml proteinase K (Life Technologies, cat. no. AM2542)
  • 25:24:1 phenol/chloroform/isoamyl alcohol (unit 2.1)
  • Chloroform
  • 20 mg/ml glycogen (Life Technologies, cat. no. 10814‐010)
  • 100% ethanol and 70% ethanol
  • TE 0.1 buffer (see recipe)
  • Quant‐iT PicoGreen dsDNA assay kit (Life Technologies, cat. no. P11496)
  • DynaMag‐2 magnetic microcentrifuge tube rack (Life Technologies)
  • Low‐retention 50‐ and 15‐ml conical tubes, 1.5‐ml microcentrifuge tubes, and pipet tips
  • Nutator or end‐over‐end rotator in refrigerated 4°C room
  • 500 ml Nalgene PPCO centrifuge bottle with sealing enclosure (Thermo Scientific, cat. no. 3141‐0250)
  • DuPont Sorvall RC‐5B refrigerated centrifuge, or equivalent
  • Refrigerated centrifuge with rotor adapters for 50‐ml and 15‐ml conical tubes
  • Refrigerated microcentrifuge
  • Spectrophotometer
  • Liquid N 2 container
  • 20‐ and 26‐G needles with 5‐ml syringe
  • 70°C and 100°C (boiling) water baths
  • Additional reagents and equipment for counting yeast cells [unit 13.2 (Treco and Winston, ) and unit 1.2 (Elbing and Brent, )] and phenol extraction/ethanol precipitation of DNA (unit 2.1; Moore and Dowhan, )

Basic Protocol 2: Native Chromatin Immunoprecipitation of Transcription Factors in Drosophila Cultured Cells

  Materials
  • Drosophila S2 cells (Drosophila Genomics Resource Center, DGRC)
  • Complete Schneider's medium (see recipe)
  • Phosphate‐buffered saline (PBS; see recipe)
  • TM2+ buffer (see recipe)
  • 10% (v/v) NP‐40
  • TM2+I buffer (see recipe)
  • 0.2 M CaCl 2 (see recipe)
  • 40 U/μl USB Affymetrix MNase (see recipe)
  • 0.2 M EGTA
  • TM2+IS buffer (see recipe)
  • 80TM+IS buffer (see recipe)
  • Antibody directed against the regulatory factor of interest (the antibody efficiency may depend on antigen accessibility in native chromatin, and must be determined on a case‐by‐case basis; mouse, rat, and rabbit IgG antibodies are captured by protein G‐coupled beads)
  • Protein G‐coupled Magnetic Beads (Dynabeads, Life Technologies, cat no 10004D)
  • 250 U/μl Benzonase (Sigma, cat. no. E1014)
  • 4× SDS sample buffer (Life Technologies, cat no. NP0007)
  • 0.5 M EDTA (see recipe)
  • 5 M NaCl (see recipe)
  • 10 mg/ml RNase A (Thermo Scientific, cat no. EN0531)
  • 10% (w/v) sodium dodecyl sulfate (SDS)
  • 20 mg/ml proteinase K (Life Technologies, cat. no. AM2542)
  • 25:24:1 phenol/chloroform/isoamyl alcohol (unit 2.1)
  • Chloroform
  • 3 M sodium acetate ( appendix 22)
  • 20 mg/ml glycogen (Life Technologies, cat. no. 10814‐010)
  • 100% and 70% ethanol
  • TE 0.1 buffer (see recipe)
  • Quant‐iT PicoGreen dsDNA assay kit. (Life Technologies, cat. no. P11496)
  • 75‐cm2 (T‐75) culture flasks
  • Cell scrapers
  • Hemacytometer or automated cell counter
  • 15‐ and 50‐ml conical tubes
  • Refrigerated centrifuge with adaptors for 50‐ml conical tubes, 15‐ml conical tubes, and 1.5‐ml microcentrifuge tubes
  • Low‐retention 1.5‐ml microcentrifuge tubes and pipet tips
  • 37°C heating block or water bath
  • 26‐G ½‐in. needle with 1‐ml syringe
  • Nutator
  • DynaMag‐2 magnetic microcentrifuge tube rack (Life Technologies)
  • 65° and 100°C (boiling) water baths
  • Additional reagents and equipment for counting cells (UNTI ; Elbing and Brent, ) and phenol extraction/ethanol preciptitation of DNA (unit 2.1; Moore and Dowhan, )

Basic Protocol 3: Library Preparation for Paired‐End Illumina Sequencing

  Materials
  • Commercial paired‐end adapters and PCR primers from Illumina TruSeq (or custom‐made adapters and primers can be used); adapters and primer sequences are as follows:
    • TruSeq Universal Adapter: 5′‐AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
    • TruSeq Indexed Adapter: 5′‐[P]GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTT*G
    • Library Enrichment Primers:
    • P5 PCR Primer: 5′ AATGATACGGCGACCACCGAG
    • P7 PCR Primer: 5′ CAAGCAGAAGACGGCATACGAG
    • In the above sequences [P] indicates a 5′‐phosphate group on the indexed adapter; * indicates a phosphorothioate bond between the two last bases at the 3′ end of adapters; NNNNNN indicates a 6‐base barcode for multiplexing sequencing reactions
  • TE buffer ( appendix 22)
  • UltraPure, nuclease free water
  • 10× T4 ligase buffer (New England Biolabs, cat. no. B0202S) containing 10 mM dATP
  • dNTP mix: 10 mM each dNTP (Life Technologies, cat. no. 18427‐013; also see appendix 22)
  • 5 U/μl T4 DNA polymerase (Invitrogen, cat. no.100004994)
  • 5 U/μl Klenow fragment (DNA polymerase I large fragment; New England Biolabs, cat. no. M0210L)
  • 10 U/μl T4 PNK (New England Biolabs, cat. no. M0201L)
  • 25:24:1 phenol/chloroform/isoamyl alcohol (unit 2.1; Moore and Dowhan, )
  • Illustra microspin HR S‐300 columns (GE Healthcare Life Sciences, cat. no. 27‐5130‐01)
  • 10× NEBuffer 2 (New England Biolabs, cat. no. B7002S)
  • 1 mM dATP (see recipe)
  • Klenow fragment (3′→5′ exo‐; New England Biolabs, cat. no. M0212M)
  • Nuclease‐free H 2O
  • 2× Rapid Ligase Buffer (Enzymatics, cat. no. B1010L)
  • Rapid DNA Ligase (Enzymatics, cat. no. L6030‐HC‐L)
  • AMPure XP magnetic beads (Agencourt, cat. no. A63880)
  • 70% ethanol
  • TE 0.1 buffer (see recipe)
  • KAPA HiFi HotStart DNA Polymerase with dNTPs (KAPA Biosystems, cat. no. KK2501)
  • Thermal cycler
  • Low‐retention 1.5‐ml and 0.5‐ml microcentrifuge tubes and pipet tips
  • 20°C water bath
  • SpeedVac evaporator
  • DynaMag‐2 magnetic microcentrifuge tube rack (Life Technologies)

Support Protocol 1: Size Selection of Immunoprecipitated DNA Fragments

  Materials
  • Agencourt AMPure XP beads (Beckman Coulter, cat. no. A63880) or equivalent custom made SPRI beads (see Commentary)
  • 70% and 100% ethanol
  • TE 0.1 buffer, pH 8.0 (see recipe)20 mg/ml glycogen (Life Technologies, cat. no. 10814‐010)
  • 5 M NaCl (see recipe)
  • 1× TBE (see recipe)
  • SYBR Gold nucleic acid gel stain (Life Technologies, cat. no. S‐11494)
  • 10% and 6% TBE acrylamide gels prepared according to standard methods
  • 10‐bp DNA ladder (Life Technologies, cat. no. 10821‐015)
  • DynaMag‐2 magnetic microcentrifuge tube rack (Life Technologies)
  • Siliconized low‐retention microcentrifuge tubes.
  • Low‐retention 20‐, 250‐, and 1000‐μl pipet tips with aerosol filter barriers
  • Refrigerated microcentrifuge.
  • Novex XCell SureLock Mini‐Cell (Life Technologies, cat. no. EI0001) or equivalent electrophoresis equipment with power supply
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E., Clementi, L., Ren, J., Li, W.W., and Noble, W.S. 2009. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. (Web Server issue):W202‐W208.
  Biggin, M.D. 2011. Animal transcription networks as highly connected, quantitative continua. Dev. Cell 21:611‐626.
  Elbing, K. and Brent, R. 2002. Growth in liquid media. Curr. Protoc. Mol. Biol. 59:1.2.1‐1.2.2.
  Goecks, J., Nekrutenko, A., Taylor, J., and Galaxy Team. 2010. Galaxy: A comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol. 11:R86.
  Henikoff, S. and Henikoff, J.G. 2012. “Point” centromeres of Saccharomyces harbor single centromere‐specific nucleosomes. Genetics 190:1575‐1577.
  Jackson, V. 1978. Studies on histone organization in the nucleosome using formaldehyde as a reversible cross‐linking agent. Cell 15:945‐954.
  Jackson, V. 1999. Formaldehyde cross‐linking for studying nucleosomal dynamics. Methods 17:125‐139.
  Kasinathan, S., Orsi, G.A., Zentner, G.E., and Ahmad, K., 2014. Henikoff, S. High‐resolution mapping of transcription factor binding sites on native chromatin. Nat. Methods 11:203‐209.
  Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., and Haussler, D. 2002. The human genome browser at UCSC. Genome Res. 12:996‐1006.
  Krassovsky, K., Henikoff, J.G., and Henikoff, S. 2012. Tripartite organization of centromeric chromatin in budding yeast. Proc. Natl. Acad. Sci. U.S.A. 109:243‐248.
  Lohman, T.M. and Mascotti, D.P. 1992. Thermodynamics of ligand‐nucleic acid interactions. Methods Enzymol. 212:400‐424.
  MacIsaac, K.D. and Fraenkel, E. 2006. Practical strategies for discovering regulatory DNA sequence motifs. PLoS Comput Biol. 2:e36.
  Macisaac, K.D. and Fraenkel, E. 2010. Sequence analysis of chromatin immunoprecipitation data for transcription factors. Methods Mol Biol. 674:179‐193.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
  Neph, S., Vierstra, J., Stergachis, A.B., Reynolds, A.P., Haugen, E., Vernot, B., Thurman, R.E., John, S., Sandstrom, R., Johnson, A.K., Maurano, M.T., Humbert, R., Rynes, E., Wang, H., Vong, S., Lee, K., Bates, D., Diegel, M., Roach, V., Dunn, D., Neri, J., Schafer, A., Hansen, R.S., Kutyavin, T., Giste, E., Weaver, M., Canfield, T., Sabo, P., Zhang, M., Balasundaram, G., Byron, R., MacCoss, M.J., Akey, J.M., Bender, M.A., Groudine, M., Kaul, R., and Stamatoyannopoulos, J.A. 2012. An expansive human regulatory lexicon encoded in transcription factor footprints. Nature. 489:83‐90.
  Orsi, G.A., Kasinathan, S., Hughes, K.T., Saminadin‐Peter, S., Henikoff, S., and Ahmad, K. 2014. High‐resolution mapping defines the cooperative architecture of Polycomb response elements. Genome Res. 24:809‐820.
  Park, D., Lee, Y., Bhupindersingh, G., and Iyer, V.R. 2013. Widespread misinterpretable ChIP‐seq bias in yeast. PLoS One. 8:e83506.
  Poorey, K., Viswanathan, R., Carver, M.N., Karpova, T.S., Cirimotich, S.M., McNally, J.G., Bekiranov, S., and Auble, D.T. 2013. Measuring chromatin interaction dynamics on the second time scale at single‐copy genes. Science 342:369‐372.
  Rohland, N. and Reich, D. 2012. Cost‐effective, high‐throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22:939‐946.
  Teves, S.S. and Henikoff, S. 2011. Heat shock reduces stalled RNA polymerase II and nucleosome turnover genome‐wide. Genes Dev. 25:2387‐2397.
  Teytelman, L., Thurtle, D.M., Rine, J., and van Oudenaarden, A. 2013. Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins. Proc. Natl. Acad. Sci. U.S.A. 110:18602‐18607.
  Treco, D. A. and Winston, F. 2008. Growth and manipulation of yeast. Curr. Protoc. Mol. Biol. 82:13.2.1‐13.2.12.
  Wilkins, R.C. and Lis, J.T. 1998. GAGA factor binding to DNA via a single trinucleotide sequence element. Nucleic Acids Res. 26:2672‐2678.
  Worsley Hunt, R. and Wasserman, W.W. 2014. Non‐targeted transcription factors motifs are a systemic component of ChIP‐seq datasets. Genome Biol. 15:412.
  Zentner, G.E. and Henikoff, S. 2013. Mot1 redistributes TBP from TATA‐containing to TATA‐less promoters. Mol. Cell Biol. 33:4996‐5004.
  Zentner, G.E., Tsukiyama, T., and Henikoff, S. 2013. ISWI and CHD chromatin remodelers bind promoters but act in gene bodies. PLoS Genet. 9:e1003317.
  Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, X.S. 2008. Model‐based analysis of ChIP‐Seq (MACS). Genome Biol. 9:R137.
Key References
  Kasinathan et al., 2014. See above.
  First description of the ORGANIC procedure and characterization of transcription factor binding in yeast and Drosophila. This paper developed the ORGANIC profiling protocol for native immunoprecipitation of Saccharomyces and Drosophila transcription factors, and compared it to cross‐linking ChIP methods.
  Orsi et al., 2014. See above.
  This paper uses MNase‐seq and ORGANIC profiling to describe the cooperative transcription factor complexes at Drosophila Polycomb Response Elements. Demonstrates the utility of ORGANIC to identify cooperative transcription factor binding and map transcription factor‐bound complexes.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library