Profiling Human Gene Expression with cDNA Microarrays

Yuan Jiang1, John Lueders1, Arthur Glatfelter1, Chris Gooden1, Michael Bittner1

1 National Human Genome Research Institute, NIH, Bethesda, Maryland
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 22.3
DOI:  10.1002/0471142727.mb2203s53
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

As a result of genomics initiatives worldwide, it has become increasingly easy to obtain cDNA clones representing the 3' ends of many human genes. This unit describes methods that allow these clones to be used as hybridization detectors in a highly parallel assay of gene expression. Protocols are provided for preparing cDNA microarrays, extracting RNA from cells of interest and preparing fluorescently labeled cDNA representations of the message pools, and hybridizing the labeled cDNAs to the microarrays.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: cDNA Amplification and Printing
  • Basic Protocol 2: RNA Extraction and Labeling
  • Basic Protocol 3: Hybridization and Data Extraction
  • Support Protocol 1: Agarose Gel Electrophoresis of ESTs
  • Support Protocol 2: Fluorometric Determination of DNA Concentration
  • Support Protocol 3: Coating Slides with Poly‐L‐Lysine
  • Reagents and Solution
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: cDNA Amplification and Printing

  Materials
  • Master set of clone‐purified, sequence verified human ESTs (e.g., gf211 release, Research Genetics) in bacterial cells
  • LB medium (Biofluids, or see unit 1.1) containing 100 µg/ml carbenicillin (added from 100 mg/ml stock; see )
  • 70% ethanol
  • 100% denatured ethanol
  • Super Broth (Biofluids) containing 100 µg/ml carbenicillin (add from recipe100 mg/ml carbenicillin stock; see recipe)
  • 45% (w/v) glycerol (enzyme grade, sterilize by autoclaving and store at room temperature)
  • 96‐well alkaline lysis miniprep kit (Edge BioSystems)
  •  Lysis buffer
  •  RNase solution
  •  Resuspension buffer
  •  96‐well receiving plates and filter plates
  •  Precipitation buffer
  •  Neutralization buffer
  •  Wide‐bore pipet tips
  •  Deep‐well plates
  • recipeT low E buffer (see recipe)
  • 10× PCR buffer
  • 100 mM dATP
  • 100 mM dGTP
  • 100 mM dCTP
  • 100 mM dTTP
  • 1 mM PCR primer AEK M13F (5′‐GTTGTAAAACGACGGCCAGTG‐3′)
  • 1 mM PCR primer AEK M13R (5′‐CACACAGGAAACAGCTATG‐3′)
  • Taq DNA polymerase (AmpliTaq, PE Biosystems), store at –20°C
  • recipeEthanol/acetate solution (see recipe)
  • 20× SSC ( appendix 22)
  • Succinic anhydride (Sigma‐Aldrich)
  • 1‐methyl‐2‐pyrrolidinone (Sigma‐Aldrich)
  • recipe1 M sodium borate, pH 8.0 (see recipe)
  • 96‐well round‐bottom and V‐bottom plastic cell culture plates (Corning)
  • Centrifuge with a horizontal microplate carrier with a depth capacity of 6.2 cm for spinning microtiter plates and filtration plates (e.g., Sorvall Super T 21, Sorvall with ST‐H750 microplate carrier rotor)
  • 96‐pin multi‐blot replicator (V&P Scientific)
  • Household 1‐gallon sealable storage bags (e.g., Glad Lock)
  • Deep‐well plates
  • Microporous tape sheets (e.g., AirPore Tape Sheets, Qiagen)
  • Platform shaker with holders for deep‐well plates at 37°C
  • Sterile 96‐well plate seals (e.g., Elkay Products)
  • Thin‐wall 96‐well PCR plates and PCR plate sealer (e.g., CycleSeal plate sealer, Robbins Scientific)
  • 96‐well thermal cycler (MJ Research)
  • Microtiter plate washer (e.g., Immunowash Microplate washer, Bio‐Rad)
  • Heat sealable storage bags and heat sealer
  • 65°C incubator
  • Robotic slide printer (e.g., GeneMachines, Genetic Microsystems, Genetix, Cartesian Technologies) and pens (e.g., Majer Precision Engineering, TeleChem International)
  • Diamond scribe for writing on slides
  • Slide box, plastic with no paper or cork liners (e.g., PGC Scientifics)
  • ∼24 × 34 × 5‐cm Pyrex baking dish
  • Poly‐L‐lysine‐coated glass slides (see protocol 6)
  • 30‐slide stainless steel rack and 30‐slide glass tank (Shandon/Lipshaw)
  • 1‐liter glass tank
  • Additional reagents and equipment for fluorometric DNA determination (see protocol 5) and agarose gel electrophoresis (see protocol 4)

Basic Protocol 2: RNA Extraction and Labeling

  Materials
  • Cells harvested from tissue culture, in tissue culture, or whole frozen tissue
  • recipePhosphate‐buffered saline (PBS; see recipe)
  • TRIzol reagent (Life Technologies)
  • Chloroform
  • 100%, 75%, 70% ethanol
  • RNeasy Maxi Kit (Qiagen)
  •  50‐ml Maxi spin columns with collection tubes
  •  RW1 buffer
  •  RPE buffer
  •  DEPC‐treated water (provided with kit or see unit 4.1)
  • 3 M sodium acetate, pH 5.2 ( appendix 22)
  • 2 mg/ml anchored oligo‐dT primer (anchored; 5′‐TTT TTT TTT TTT TTT TTT TTV N‐3′; e.g., Genosys)
  • 1 mg/ml pd(T)12‐18 (Amersham Pharmacia Biotech)
  • recipe10× low‐T dNTP mix (see recipe)
  • 1 mM Cy 3‐dUTP or Cy 5‐dUTP, store –20°C, light sensitive
  • RNasin RNase inhibitor (Promega)
  • Superscript II RNase H Reverse Transcriptase Kit with 5× first strand buffer and 1 M DTT (Life Technologies)
  • 0.5 M EDTA, pH 8.0 ( appendix 22)
  • 1 N NaOH
  • 1 M Tris⋅Cl, pH 7.5 ( appendix 22)
  • TE buffer, pH 7.5 ( appendix 22)
  • 1 mg/ml C 0t‐1 DNA (Life Technologies)
  • 2% (w/v) agarose gel (6‐cm wide × 8.5‐cm long, 2‐mm wide wells) in TAE buffer
  • 50× TAE buffer ( appendix 22)
  • Tissue homogenizer (e.g., Polytron PT1200, Brinkmann Instruments)
  • 15‐ml round‐bottom polypropylene centrifuge tubes
  • 50‐ml conical polypropylene centrifuge tubes
  • Clinical centrifuge with horizontal rotor for 50‐ml conical tubes
  • 1.5‐ml microcentrifuge tubes
  • Centrifugal filter units (e.g., Microcon YM‐100, Amicon)
  • 0.2‐ml thin‐wall PCR tube with cap
  • Thermal cycler
  • Fluorescence scanner (e.g., Storm system for gel analysis, Molecular Dynamics)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)
NOTE: Use RNase‐free water (e.g., DEPC‐treated water, unit 4.1) to make up all solutions, unless indicated otherwise.

Basic Protocol 3: Hybridization and Data Extraction

  Materials
  • Glass microarrays (see protocol 1)
  • Cy3‐ and Cy5‐labeled cDNAs (see protocol 2)
  • DEPC‐treated water (unit 4.1)
  • 8 mg/ml poly(dA)40‐60 (Amersham Pharmacia Biotech)
  • recipe4 mg/ml yeast tRNA (see recipe)
  • recipe10 mg/ml human C 0t‐1 DNA (see recipe)
  • 20× SSC ( appendix 22)
  • 50× Denhardt's solution ( appendix 22)
  • 10% SDS
  • recipe0.5× SSC/0.01% SDS wash buffer (see recipe)
  • recipe0.06× SSC wash buffer (see recipe)
  • 0.2‐ml thin‐wall PCR tubes
  • Thermal cycler
  • 24‐mm × 50‐mm glass cover slips
  • Microarray hybridization chamber
  • 65°C water bath
  • Microarray scanner
  • Image analysis software
NOTE: Use RNase‐free water (e.g., DEPC‐treated water, unit 2.5) to make up all solutions, unless indicated otherwise.

Support Protocol 1: Agarose Gel Electrophoresis of ESTs

  Materials
  • 2% (w/v) agarose gel in 1× TAE buffer (see unit 2.5)
  • 50× TAE buffer ( appendix 22)
  • recipeLoading buffer (see recipe)
  • recipe100‐bp size standards (see recipe)
  • Electrophoresis apparatus with capacity for four 50‐well combs, (e.g., Owl Scientific)
  • Disposable microtiter mixing trays (e.g., Becton Dickinson)
  • Programmable, 12‐channel pipettor with disposable tips (e.g., Matrix Technologies)
  • Electrophoresis power supply
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5)

Support Protocol 2: Fluorometric Determination of DNA Concentration

  Materials
  • FluoReporter Blue dsDNA Quantitation Kit (Molecular Probes)
  • recipeFluor buffer (see recipe)
  • PCR product (see protocol 3)
  • TE buffer, pH 8 ( appendix 22)
  • recipe50, 100, 250, and 500 µg/ml dsDNA reference standards (e.g., see recipe)
  • 96‐well plates for fluorescent detection (e.g., Dynex)
  • 12‐channel multipipettor
  • Fluorometer (e.g., PE Biosystems)
  • Computer equipped with Microsoft Excel software

Support Protocol 3: Coating Slides with Poly‐L‐Lysine

  Materials
  • recipeCleaning solution (see recipe)
  • recipePoly‐L‐lysine solution (see recipe)
  • Gold Seal microscope slides (Becton Dickinson)
  • 50‐slide stainless steel rack and 50‐slide glass tank (Wheaton)
  • 25‐slide plastic rack and 25‐slide plastic box (Shandon Lipshaw)
  • Plastic slide box with no paper or cork liners (e.g., PGC Scientific)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Alwine, J.C., Kemp, D.J., and Stark, G.R. 1977. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl‐paper and hybridization with DNA probes. Proc. Natl. Acad. Sci. USA 74:5350‐5354.
   Bishop, J.O., Morton, J.G., Rosbash, M., and Richardson, M. 1974. Three abundance classes in HeLa cell messenger RNA. Nature 250:199‐204.
   DeRisi, J.L., Iyer, V.R., and Brown, P.O. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale Science 278:680‐686.
   Iyer, V.R., Eisen, M.B., Ross, D.T., Schuler, G., Moore, T., Lee, J.C.F., Trent, J.M., Staudt, L.M., Hudson, J. Jr., Boguski, M.S., Lashkari, D., Shalon, D., Botstein, D., and Brown, P.O. 1999. The transcriptional program in the response of human fibroblasts to serum. Science 283:83‐87.
   Khan, J., Simon, R., Bittner, M., Chen, Y., Leighton, S.B., Pohida, T., Smith, P.D., Jiang, Y., Gooden, G.C., Trent, J.M., and Meltzer, P.S. 1998. Gene expression profiling of alveolar rhabdomyosarcoma with cDNA microarrays. Cancer Res. 58:5009‐5013.
   Lockhart, D.J., Dong, H., Byrne, M.C., Follettie, M.T., Gallo, M.V., Chee, M.S., Mittmann, M., Wang, C., Kobayashi, M., Horton, H., and Brown, E.L. 1996. Expression monitoring by hybridization to high‐density oligonucleotide arrays. Nat. Biotechnol. 14:1675‐1680.
   Phimister, B.E. 1999. The chipping forecast. Nat. Genet. 21 (1 Suppl).
   Schena, M., Shalon, D., Davis, R.W., and Brown, P.O. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270:467‐470.
   Spellman, P.T., Sherlock, G., Zhang, M.Q., Iyer, V.R., Anders, K., Eisen, M.B., Brown, P.O., Botstein, D., and Futcher, B. 1998. Comprehensive identification of cell cycle‐regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 9:3273‐3297.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library