Mouse Embryonic Stem (ES) Cell Isolation

David A. Conner1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 23.4
DOI:  10.1002/0471142727.mb2304s52
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Building on the technology presented in earlier units of Chapter 23, this unit describes the basic method for the isolation of mouse embryonic (ES) stem cells. ES cells from wild‐type mice may be used for the production of mouse mutants by homologous recombination and blastocyst‐mediated transgenesis. ES cells from mutant mouse lines may be used in the analysis of mutant phenotypes.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Isolation of Mouse ES Cells
  • Support Protocol 1: ES Cell Sex Determination
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of Mouse ES Cells

  Materials
  • Modified ES medium (see recipe)
  • Blastocysts, 3.5‐day‐old post‐coitum embryos (Hogan et al., )
  • Hanks' balanced salt solution (HBSS), calcium‐ and magnesium‐free (unit 23.2)
  • DPBS‐EDTA (unit 23.3)
  • 0.25% (w/v) trypsin‐EDTA (unit 23.2)
  • Inverted microscope
  • Gilson‐style automatic pipettor with 20‐µl pipet tips
  • 96‐well U‐bottom plate
  • Additional reagents and equipment for preparing gelatin‐coated plates with MEF feeder layers for embryonic stem cell culture (unit 23.3) and for passaging and freezing embryonic stem cells (unit 23.3)
NOTE: All cell culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 1: ES Cell Sex Determination

  • Digestion buffer (unit 23.5)
  • Saturated NaCl
  • 95% ethanol
  • 10× amplification buffer (unit 15.1)
  • 25 mM 4dNTP mix (unit 15.1)
  • Primers (Kunieda et al., ):
  •  Set 1: SRY2: TCTTAAACTCTGAAGAAGAGAC
  •     SRY4: GTCTTGCCTGTATGTGATGG
  •  Set 2: NDS3: GAGTGCCTCATCTATACTTACAG
  •     NDS4: TCTAGTTCATTGTTGAGTTGC
  • 5 U/µl Taq DNA polymerase
  • 3% (w/v) agarose gel
  • Molecular weight markers
  • 1.5‐ml microcentrifuge tubes
  • 55°C incubator
  • Additional reagents and equipment for PCR amplification (unit 15.1), culture of ES cells (units 23.2 and 23.3), and agarose gel electrophoresis (unit 2.5)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Axelrod, H.R. 1984. Embryonic stem cell lines derived from blastocysts by a simplified technique. Devel. Biol. 101:225‐228.
   Evans, M.J. and Kaufman, M.H. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154‐156.
   Festing, F.W., Simpson, E.M., Davisson, M.T., and Mobraaten, L.E. 1999. Revised nomenclature for strain 129 mice. Mamm. Genome 10:836.
   Hogan, B., Beddington, R., Constantini, F., and Lacy, E. 1994. Manipulating the Mouse Embryo: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
   Kitani, H., Takagi, N., Atsumi, T., Kawakura, K., Imamura, K., Goto, S., Kusakabe, M., and Fukuta, K. 1996. Isolation of a germline‐transmissible embryonic stem (ES) cell line from C3H/He mice. Zool. Sci. 13:865‐871.
   Kunieda, T., Xian, M., Kobayashi, E., Imamichi, T., Moriwaki, K., and Toyoda, Y. 1992. Sexing of mouse preimplantation embryos by detection of Y chromosome‐specific sequences using polymerase chain reaction. Biol. Reprod. 46:692‐697.
   Ledermann, B. and Burki, K. 1991. Establishment of a germ‐line competent C57BL/6 embryonic stem cell line. Exp. Cell Res. 197:254‐258.
   Martin, G.R. 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U.S.A. 78:7634‐7636.
   McWhir, J., Schnieke, A.E., Ansell, R., Wallace, H., Colman, A., Scott, A.R., and Kind, A.J. 1996. Selective ablation of differentiated cells permits isolation of embryonic stem cell lines from murine embryos with a non‐permissive genetic background. Nature Genet. 14:223‐226.
   Noben‐Trauth, N., Kohler, G., Burki, K., and Ledermann, B. 1996. Efficient targeting of the IL‐4 gene in a BALB/c embryonic stem cell line. Transgenic Res. 5:487‐491.
   Pease, S., Braghetta, P., Gearing, D., Grail, D., and Williams, R.L. 1990. Isolation of embryonic stem (ES) cells in media supplemented with recombinant leukemia inhibitory factor (LIF). Dev. Bio. 141:344‐352.
   Robertson, E.J. 1987. Embryo‐derived stem cell lines. In Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (E.J. Robertson, ed.) pp. 71‐112. IRL Press, Oxford.
   Robertson, E.J., Evans, M.J., and Kaufman, M.H. 1983. X‐chromosome instability in pluripotential stem cell lines derived from parthenogenetic embryos. J. Embryol. Exp. Morph. 74:297‐309.
Key References
   Hogan, B., et al., 1994. See above.
  These three references, written by experts in the field, represent the best compilations of ES culture and isolation methods.
   Robertson, E.J. 1987. See above.
   Wurst, W. and Joyner, A.L. 1993. Production of targeted embryonic stem cell clones. In Gene Targeting: A Practical Approach (A.L. Joyner, ed.) pp. 33‐61. IRL Press, Oxford.
Internet Resources
   http://www.biosupplynet.com
  Search this web site for “embryonic stem cell reagents” to obtain a current list of suppliers that provide medium and ES cells.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library