Modification and Production of BAC Transgenes

Yongsu Jeong1, Douglas J. Epstein1

1 University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 23.11
DOI:  10.1002/0471142727.mb2311s71
Online Posting Date:  August, 2005
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Bacterial artificial chromosomes (BACs) are the vectors of choice for the construction of genomic DNA libraries and, as such, have proven instrumental in the generation of large‐scale physical maps; positional cloning projects; and the sequencing of human, mouse, and a plethora of other genomes. A number of methods have recently been developed to modify BAC DNA (e.g., insertion, deletion, substitution), making BACs even more useful for functional genomic research. This unit describes two protocols for BAC modification in E. coli, one that allows for specific changes at a given DNA sequence and another that is more suited for rapid and nonspecific integration of foreign DNA (such as a reporter cassette) into a BAC insert. In addition, a simple and reliable method for preparing BAC DNA for pronuclear microinjection is also provided.

Keywords: Bacterial artificial chromosomes (BACs); Homologous recombination; Transposon; Recombineering; Transgenic mouse

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: BAC Modification by Homologous Recombination in E. coli
  • Basic Protocol 2: BAC Modification by in Vitro Transposition
  • Support Protocol 1: Preparation of BAC DNA
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: BAC Modification by Homologous Recombination in E. coli

  Materials
  • Pir2 competent cells (Invitrogen)
  • pLD53SC‐AEB shuttle vector (from the laboratory of Dr. Nathaniel Heintz, The Rockefeller University)
  • LB medium (unit 1.1)
  • LB plates (unit 1.1) supplemented with antibiotics as follows:
    • 30 µg/ml ampicillin
    • 15 µg/ml chloramphenicol and 50 µg/ml ampicillin
    • 15 µg/ml chloramphenicol and 5% (w/v) sucrose (from 50% sucrose stock solution; sterilize with 0.45‐µm filter; do not boil or autoclave)
  • 50 mg/ml ampicillin
  • Appropriate oligonucleotide primers for amplifying homology arms A and B
  • Bacteria containing BAC clone to be modified (see )
  • Restriction enzyme and buffer appropriate for cloning site in shuttle vector:
    • AscI or SmaI for homology arm A
    • PacI, FseI, or StuI for homology arm B
  • Shrimp alkaline phosphatase (Roche)
  • GeneClean (Qbiogene)
  • Primers for verifying arm insertion:
    • SCAB1: 5′‐AAGTTGTAAGGATATGCC‐3′
    • SCAB2: 5′‐CATATCGCAATACATGCG‐3′
  • 34 mg/ml chloramphenicol
  • 10% (v/v) glycerol, ice cold
  • SOC medium (unit 1.8), optional
  • Oligonucleotide primers P1 and P2 (step )
  • 37° and 42°C water baths
  • 37°C incubator, with and without shaking
  • Thermal cycler
  • 1.5‐ml microcentrifuge tubes, sterile and prechilled on ice
  • 0.1‐cm electroporation cuvettes (Bio‐Rad), prechilled on ice
  • Gene Pulser (Bio‐Rad)
  • Sterile culture tubes, such as 15‐ml (17 × 120–mm) tubes (Falcon)
  • Additional reagents and equipment for alkaline lysis miniprep (unit 1.6), PCR (unit 15.1), agarose gel electrophoresis (unit 2.5), ethanol precipitation of DNA with ammonium acetate (unit 2.1), DNA ligation (unit 3.16), DNA sequencing (see Chapter 7), electroporation (unit 1.8), Southern analysis (units 2.9& 2.10), and preparation of BAC DNA (see 23.11)

Basic Protocol 2: BAC Modification by in Vitro Transposition

  Materials
  • Pir2 competent cells (Invitrogen)
  • pGPS1‐βLacZ targeting vector (from the laboratory of Denis Duboule, University of Geneva, Switzerland)
  • LB medium (unit 1.1)
  • LB plates (unit 1.1) without antibiotics and supplemented with antibiotics as follows:
    • 20 µg/ml kanamycin
    • 20 µg/ml kanamycin and 15 µg/ml chloramphenicol
  • 20 mg/ml kanamycin
  • E. coli DH10B strain
  • 10% (v/v) glycerol, ice cold
  • BAC DNA prepared from overnight culture (see protocol 3, steps to )
  • GPS kit (New England Biolabs), including:
    • 10× GPS buffer
    • TnsABC transposase
    • Start solution
  • SOC medium (unit 1.8), optional
  • 34 mg/ml chloramphenicol
  • PCR primers:
    • β‐globin: 5′‐AGCCATCTATTGCTTACATTTGC‐3′
    • lacZ: 5′‐ATAGGTTACGTTGGTGTAGATGG‐3′
  • Appropriate restriction enzyme to confirm insertion (e.g., MluI)
  • Primer for sequencing directed against the 3′ end of the lacZ gene, optional
  • 37° and 42°C water baths
  • 37°C incubator, with and without shaking
  • 1.5‐ml microcentrifuge tubes, sterile and prechilled on ice
  • 75°C heating block
  • 0.1‐cm electroporation cuvettes (Bio‐Rad), prechilled on ice
  • Gene Pulser (Bio‐Rad)
  • Thermal cycler
  • Additional reagents and equipment for alkaline lysis DNA miniprep (unit 1.6), electroporation (unit 1.8), PCR (unit 15.1), agarose gel electrophoresis (unit 2.5), preparation of BAC DNA (see protocol 3), pulsed‐field gel electrophoresis (unit 2.5), and DNA sequencing (see Chapter 7; optional)

Support Protocol 1: Preparation of BAC DNA

  Materials
  • Bacterial strain containing BAC of interest (see Basic Protocols protocol 11 and protocol 22 and see )
  • LB medium (unit 1.1)
  • Antibiotics appropriate for BAC strain of interest
  • Resuspension solution: 50 mM Tris⋅Cl, pH 8.0 ( appendix 22)/10 mM EDTA
  • 10 mg/ml RNase A
  • Lysis solution: 200 mM NaOH ( appendix 22)/1% (w/v) SDS
  • Neutralization solution: 3.0 M potassium acetate, pH 5.5
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol, pH 6.7
  • Chloroform
  • 75% and 100% (v/v) ethanol
  • TE buffer, pH 8.0 ( appendix 22)
  • 3 M sodium acetate, pH 7.0 (for pronuclear microinjection only)
  • Microinjection buffer: 10 mM Tris⋅Cl, pH 7.4 ( appendix 22)/0.1 mM EDTA (store ≤6 months at room temperature; for pronuclear microinjection only)
  • Size markers for gel electrophoresis (e.g., DNA Quanti‐Ladder, OriGene Technologies; for pronuclear microinjection only)
  • PI‐SceI and 10× reaction buffer (New England Biolabs; for pronuclear microinjection only)
  • 37°C incubator, with shaking
  • Microcentrifuge, room temperature and 4°C
  • Pipet tip with large orifice
  • 65°C heat block (for pronuclear microinjection only)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5) and pulsed‐field gel electrophoresis (see protocol 2)
NOTE: Reagents and water for pronuclear microinjection buffer must be tissue culture grade.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Chartier, C., Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A., and Mehtali, M. 1996. Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J. Virol. 70:4805‐4810.
   Gong, S., Yang, X.W., Li, C., and Heintz, N. 2002. Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kγ origin of replication. Genome Res. 12:1992‐1998.
   Lee, E.C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D.A., Court, D.L., Jenkins, N.A., and Copeland, N.G. 2001. A highly efficient Escherichia coli‐based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73:56‐65.
   Shizuya, H., Birren, B., Kim, U.J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. 1992. Cloning and stable maintenance of 300‐kilobase‐pair fragments of human DNA in Escherichia coli using an F‐factor‐based vector. Proc. Natl. Acad. Sci. U.S.A. 15:8794‐8797.
   Spitz, F., Gonzalez, F., and Duboule, D. 2003. A global control region defines a chromosomal regulatory landscape containing the HoxD cluster. Cell 113:405‐417.
   Zhang, Y., Buchholz, F., Muyrers, J.P., and Stewart, A.F. 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20:123‐128.
Internet Resources
   http://www.genome.ucsc.edu/cgi‐bin/hgGateway
  Individual BAC clones that overlap a gene or genomic region of interest can be identified using the Genome Browser Gateway of the Genome Bioinformatics Group of the University of California Santa Cruz.
   http://bacpac.chori.org/
  BACs can be ordered from the BACPAC Resources Center at the Children's Hospital Oakland Research Institute.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library