Regulation of Transgene Expression Using Tetracycline

James Gulick1, Jeffrey Robbins1

1 Cincinnati Children's Hospital, University of Cincinnati, Cincinnati, Ohio
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 23.12
DOI:  10.1002/0471142727.mb2312s71
Online Posting Date:  August, 2005
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Transgenesis has proven useful in creating animal models that mimic certain disease states, providing a mechanistic approach for understanding the underlying disease mechanisms at the molecular and cellular levels. With traditional transgenics, the gene of interest is cloned behind a promoter that has the desired expression pattern, allowing the gene to be expressed in those tissues at the developmental times that the promoter is active. In order to more precisely control gene expression both in vitro and in vivo, inducible systems that use pharmacologic intervention to control transgene expression have been developed (UNIT 16.14). As previously described, the system consists of two components, an activator that is regulated by tetracycline and a responder that is dependent upon the activator. Both limbs of the system will be discussed in the context of inducible and reversible transgene expression that is cell type– or organ‐specific, with particular attention paid to the cardiovascular system.

Keywords: transgenic; inducible; tetracycline; mouse; genetics

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Mouse line that expresses tTA in cell‐ or tissue‐specific manner
  • Mouse line that contains the cDNA of the gene of interest cloned behind the responder promoter
  • Ear clip digest buffer (see recipe)
  • PCR primers for screening the tet‐off (tTA) construct:
    • AGCGCATTAGAGCTGCTTAATGAGGTC (forward)
    • GTCGTAATAATGGCGGCATACTATC (reverse)
  • PCR primers for the cDNA being expressed (see unit 15.1 for principles of primer design)
  • Drinking water containing doxycycline (0.2 to 2 g/liter; see recipe) or prepackaged, irradiated mouse chow containing doxycycline (e.g., 625 mg/kg; Harlan Teklad)
  • Light‐protected (dark‐glass or foil‐wrapped) water bottles for mice
  • 4.5‐cm stainless steel ear punch (Fine Science Tools)
  • Additional reagents and equipment for maintenance and care of transgenic animals (units 23.8& 23.10), PCR (unit 15.1), northern blotting (unit 4.9), quantitative PCR (unit 15.7), and immunoblotting (unit 10.8)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Baron, U., Gossen, M., and Bujard, H. 1997. Tetracycline‐controlled transcription in eukaryotes: Novel transactivators with graded transactivation potential. Nucl. Acids Res. 25:2723‐2729.
   Clark, J.C., Tichelaar, J.W., Wert, S.E., Itoh, N., Perl, A.K., Stahlman, M.T., and Whitsett, J.A. 2001. FGF‐10 disrupts lung morphogenesis and causes pulmonary adenomas in vivo. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L705‐L715.
   Gossen, M., Bonin, A.L., Freundlieb, S., and Bujard, H. 1994. Inducible gene expression systems for higher eukaryotic cells. Curr. Opin. Biotechnol. 5:516‐520.
   James, J. and Robbins, J. 1997. Molecular remodeling of cardiac contractile function. Am. J. Physiol. 273:H2105‐H2118.
   Ng, W.A., Grupp, I.L., Subramaniam, A., and Robbins, J. 1991. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ. Res. 68:1742‐1750.
   Palermo, J., Gulick, J., Colbert, M., Fewell, J., and Robbins, J. 1996. Transgenic remodeling of the contractile apparatus in the mammalian heart. Circ. Res. 78:504‐509.
   Perl, A.K., Hokuto, I., Impagnatiello, M.A., Christofori, G., and Whitsett, J.A. 2003. Temporal effects of Sprouty on lung morphogenesis. Dev. Biol. 258:154‐168.
   Robbins, J., Palermo, J., and Rindt, H. 1995. In vivo definition of a cardiac specific promoter and its potential utility in remodeling the heart. Ann. N.Y. Acad. Sci. 752:492‐505.
   Russell, L.K., Mansfield, C.M., Lehman, J.J., Kovacs, A., Courtois, M., Saffitz, J.E., Medeiros, D.M., Valencik, M.L., McDonald, J.A., and Kelly, D.P. 2004. Cardiac‐specific induction of the transcriptional coactivator peroxisome proliferator‐activated receptor gamma coactivator‐1alpha promotes mitochondrial biogenesis and reversible cardiomyopathy in a developmental stage‐dependent manner. Circ. Res. 94:525‐533.
   Sanbe, A., Gulick, J., Hanks, M.C., Liang, Q., Osinska, H., and Robbins, J. 2003. Reengineering inducible cardiac‐specific transgenesis with an attenuated myosin heavy chain promoter. Circ. Res. 92:609‐616.
   Shockett, P., Difilippantonio, M., Hellman, N., and Schatz, D.G. 1995. A modified tetracycline‐regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 92:6522‐6526.
   Subramaniam, A., Gulick, J., Neumann, J., Knotts, S., and Robbins, J. 1993. Transgenic analysis of the thyroid‐responsive elements in the alpha‐cardiac myosin heavy chain gene promoter. J. Biol. Chem. 268:4331‐4336.
   Tsai, S.Y., O'Malley, B.W., DeMayo, F.J., Wang, Y., and Chua, S.S. 1998. A novel RU486 inducible system for the activation and repression of genes. Adv. Drug Deliv. Rev. 30:23‐31.
   Urlinger, S., Baron, U., Thellmann, M., Hasan, M.T., Bujard, H., and Hillen, W. 2000. Exploring the sequence space for tetracycline‐dependent transcriptional activators: Novel mutations yield expanded range and sensitivity. Proc. Natl. Acad. Sci. U.S.A. 97:7963‐7968.
   Wang, Y., DeMayo, F.J., Tsai, S.Y., and O'Malley, B.W. 1997. Ligand‐inducible and liver‐specific target gene expression in transgenic mice. Nat. Biotechnol. 15:239‐243.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library