Peptide Aptamers: Dominant “Genetic” Agents for Forward and Reverse Analysis of Cellular Processes

C. Ronald Geyer1

1 University of Florida, Gainesville, Florida
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 24.4
DOI:  10.1002/0471142727.mb2404s52
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Peptide aptamers are the newest in the class of “genetic” agents that aid in the analysis of cellular processes. Peptide aptamers interact with and can inactivate gene products, but don't mutate the DNA that encodes them. Reverse analysis with peptide aptamers involves isolating aptamers that interact with a specific protein and monitoring the resulting aptamer‐induced phenotype. Conversely, forward analysis with peptide aptamers involves expressing combinatorial libraries of aptamers within an organism and screening for aptamer‐induced variations in their phenotypes. The two‐hybrid system is used in both processes to help identify the protein interactions, and variations from the basic procedure as described in UNIT are presented here.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Construction of a Combinatorial Thioredoxin Peptide Aptamer Library
  • Basic Protocol 2: Isolation of Peptide Aptamers for Specific Proteins Using the Interaction Trap Two‐Hybrid System
  • Basic Protocol 3: Defining Recognition Specificity with Interaction Mating
  • Basic Protocol 4: Affinity Maturation of Peptide Aptamers
  • Basic Protocol 5: Forward Analysis of Cellular Processes Using Peptide Aptamers
  • Support Protocol 1: Identification of Peptide Aptamer Targets
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of a Combinatorial Thioredoxin Peptide Aptamer Library

  Materials
  • 5 U/µl Klenow DNA polymerase and 10× reaction buffer (New England Biolabs)
  • 5 mM 4dNTP mixture: 5 mM each dTTP, dATP, dGTP, and dCTP
  • 10 U/µl AvaII and 2 U/µl RsrII restriction enzymes and 10× reaction buffers (New England Biolabs)
  • 10 mM Tris⋅Cl, pH 8 ( appendix 22)
  • recipeNondenaturing loading buffer (see recipe)
  • recipeDNA elution buffer (see recipe)
  • Thioredoxin expression vector plasmid: pJM‐1, pJM‐2, or pJM‐3 (Fig. )
  • 10 U/µl calf intestinal alkaline phosphatase (CIP) and 10× reaction buffer (New England Biolabs)
  • 2000 U/µl T4 DNA ligase and 10× reaction buffer (New England Biolabs)
  • QIAquick gel extraction kit (Qiagen)
  • Ultrapure water (sterile water for irrigation preferred; Fisher Scientific)
  • E. coli MC 1061 (Bio‐Rad), electroporation competent (unit 9.3)
  • SOC medium (unit 1.8), prewarmed to 37°C
  • LB plates and liquid medium (unit 1.1) containing 50 µg/ml ampicillin
  • Large‐scale plasmid preparation kit (various commercial sources, e.g., Qiagen; optional)
  • DNA synthesizer
  • 16° and 95°C water baths
  • PCR purification column (e.g., Qiagen; optional)
  • Electroporator (e.g., Bio‐Rad Gene Pulser) with 0.2‐cm‐gap electroporation cells
  • Additional reagents and equipment for DNA synthesis; phenol/chloroform extraction and ethanol precipitation (unit 2.1); polyacrylamide gel electrophoresis (PAGE; unit 2.7); UV shadowing and elution of DNA (unit 2.7); UV spectroscopy ( appendix 3D) or ethidium bromide dot quantitation (unit 2.6); bacterial transformation (unit 1.8); and ethidium bromide/cesium chloride gradients (optional; unit 2.4)
NOTE: Activity units of enzymes are described for enzymes obtained from New England Biolabs. Other commercial sources can be used, but units should be confirmed.

Basic Protocol 2: Isolation of Peptide Aptamers for Specific Proteins Using the Interaction Trap Two‐Hybrid System

  Materials
  • DNA encoding bait protein of interest
  • Plasmid DNA: pEG202 (Fig. ), pSH18‐34 (Fig. )
  • Yeast strain: EGY48 ura3 trp1 his3 3LexA‐operator‐leu2
  • Complete minimal (CM) dropout medium (unit 13.1) and plates supplemented with either 2% (w/v) glucose (Glu) or 2% (w/v) galactose and 1% (w/v) raffinose (Gal/Raf):
    •  Glu/CM −His,−Ura (10‐cm plates and liquid medium)
    •  Glu/CM −His,−Ura,−Trp (10‐ and 15‐cm plates)
    •  Glu/CM −His,−Ura,−Trp,−Leu (10‐cm plates)
    •  Gal/Raf/CM −His,−Ura,−Trp (liquid medium)
    •  Gal/Raf/CM −His,−Ura,−Trp,−Leu (10‐ and 15‐cm plates)
  • 100 mM and 1 M lithium acetate, pH 7.5, filter sterilized
  • 50% (w/v) polyethylene glycol, mol. wt. 3350 (PEG 3350; Sigma)
  • 2 mg/ml single‐stranded carrier DNA (sodium salt Type III from salmon testes; Sigma) TE buffer ( appendix 22)
  • 40 µg/ml peptide aptamer library DNA (pJM‐1 aptamer plasmid; see protocol 1)
  • 2× glycerol storage solution: 65% (v/v) glycerol, 0.1 M MgSO 4, 25 mM Tris⋅Cl, pH 7.4 ( appendix 22)
  • 10‐cm Xgal plates (unit 13.1)
    •  Glu/CM −His,−Ura,−Trp, Xgal
    •  Gal/Raf/CM −His,−Ura,−Trp, Xgal
  • PCR primers for thioredoxin
  • 30° and 42°C incubators or water baths
  • Additional reagents and equipment for subcloning DNA (unit 3.16); manipulating yeast (unit 13.2); lithium acetate yeast transformation (unit 13.7); characterizing bait plasmids (unit 20.1); determination of cell density (unit 13.2) and plating efficiency (unit 20.1); replica plating (units 1.3 & 13.2); yeast plasmid preparation (unit 13.11); plasmid sequencing (unit 7.3); E. coli transformation (unit 1.8); agarose gel electrophoresis (unit 2.5); and PCR (unit 15.1)

Basic Protocol 3: Defining Recognition Specificity with Interaction Mating

  Materials
  • Plasmid DNA: pBait(s) (see protocol 2), peptide aptamer preys (see protocol 2), pEG202(Fig. ), pJG4‐5 (Fig. ), pSH18‐34 (Fig. )
  • Yeast strains:
    •  EGY42: Matα ura3 trp1 his3 leu2
    •  EGY48: Mata ura3 trp1 his3 3LexA‐operator‐leu2)
  • 10‐cm complete minimal (CM) dropout plates (unit 13.1) supplemented with either 2% (w/v) glucose (Glu) or 2% (w/v) galactose and 1% (w/v) raffinose (Gal/Raf):
    •  Glu/CM −Trp
    •  Glu/CM −His,−Ura
    •  Glu/CM −His,−Ura,−Trp,−Leu
    •  Gal/Raf/CM −His,−Ura,−Trp,−Leu
  • YPD plates (unit 13.1)
  • Xgal plates (unit 13.1):
    •  Glu/CM −His,−Ura,−Trp, Xgal
    •  Gal/Raf/CM −His,−Ura,−Trp, Xgal.
    • 30°C incubator
  • Additional reagents and equipment for lithium acetate yeast transformation (unit 13.7) and replica plating (units 1.3 & 13.2)

Basic Protocol 4: Affinity Maturation of Peptide Aptamers

  Materials
  • 5 U/µl Taq polymerase and 10× buffer (Life Technologies)
  • 1 M MgCl 2
  • 100 mM dATP
  • 100 mM dGTP
  • 100 mM dCTP
  • 100 mM dTTP
  • 20 µM primer 1: 5′‐CCGCCGCCTGAATTCATGAGCGATAAAATTATTCAC‐3′
  • 20 µM primer 2: 5′‐CGGGGCGATCATTTTGCACGGACC‐3′
  • Plasmid DNA: peptide aptamer plasmid (see protocol 2), pBait (see protocol 2), pJM‐1 (Fig. ), pRB1840 (1‐LexAop‐LacZ reporter plasmid; Fig. ), and pJK103 (Fig. )
  • Mg2+/Mn2+ solution: 45 mM MgCl 2 and 5 mM MnCl 2
  • PCR purification column (optional; e.g., Qiagen)
  • Yeast strain: EGY48 Mata ura3 trp1 his3 3LexA‐operator‐leu2
  • Complete minimal (CM) dropout medium (unit 13.1) and plates supplemented with either 2% (w/v) glucose (Glu) or 2% (w/v) galactose and 1% (w/v) raffinose (Gal/Raf):
    •  Glu/CM −His,−Ura (10‐cm plates)
    •  Glu/CM −His,−Ura,−Trp (10‐cm plates)
    •  Gal/Raf/CM −Ura,−His,−Trp (liquid medium)
    • Xgal plates (unit 13.1)
    •  Glu/CM −His,−Ura,−Trp, Xgal (10‐cm plates)
    •  Gal/Raf/CM −His,−Ura,−Trp, Xgal (10‐ and 15‐cm plates)
  • PCR tubes
  • Automated thermal cycler
  • 30°C incubator
  • Additional reagents and equipment for agarose gel electrophoresis (optional; unit 2.5), digesting and cloning peptide aptamer mutants (see protocol 1), lithium acetate yeast transformation (see protocol 2 and unit 13.7), determination of plating efficiency (unit 20.1), plasmid rescue (unit 13.11), and plasmid DNA sequencing (unit 7.3)

Basic Protocol 5: Forward Analysis of Cellular Processes Using Peptide Aptamers

  Materials
  • Yeast strain for genetic selection
  • Peptide aptamer library: pJM‐2 or pJM‐3 ( protocol 1; Fig. )
  • Complete minimal (CM) dropout liquid medium (unit 13.1) and plates supplemented with either 2% (w/v) glucose (Glu) or 2% (w/v) galactose and 1% (w/v) raffinose (Gal/Raf):
    •  Glu/CM −Trp (10‐cm plates)
    •  Gal/Raf/CM −Trp (10‐cm plates and liquid medium)
    • 30°C incubator
  • Additional reagents and equipment for high‐efficiency lithium acetate yeast transformation (see protocol 2), determination of plating efficiency (unit 20.1), isolation of plasmids (unit 13.11), plasmid DNA sequencing (unit 7.3), and target identification (see protocol 6Support Protocol)

Support Protocol 1: Identification of Peptide Aptamer Targets

  Materials
  • DNA encoding thioredoxin peptide aptamer ( protocol 5)
  • Plasmid DNA: pEG202 (Fig. ), pSH18‐34 (Fig. ), pJG4‐5 (Fig. )
  • Yeast strains:
    •  EGY42, Matα ura3 trp1 his3 leu2
    •  EGY48, Mata ura3 trp1 his3 3LexA‐operator‐leu2
  • Complete minimal (CM) dropout liquid medium (unit 13.1) and plates supplemented with either 2% (w/v) glucose (Glu) or 2% (w/v) galactose and 1% (w/v) raffinose (Gal/Raf):
    •  Glu/CM −His,−Ura (10‐cm plates)
    •  Glu/CM −Trp (10‐cm plates)
    • Prey library (see Table 97.80.4711)
  • Additional reagents and equipment for PCR (unit 15.1), standard subcloning (unit 3.16), standard lithium acetate yeast transformation (unit 13.7), interaction mating (see protocol 3), interaction trap (unit 20.1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

References
   Bai, C. and Elledge, S.J.M. 1996. Gene identification using the yeast two‐hybrid system. Methods Enzymol. 273:331‐347.
   Blum, J.H., Dove, S.L., Hochschild, A., and Mekalanos, J.J. 2000. Isolation of peptide aptamers that inhibit intracellular processes. Proc. Natl. Acad. Sci. U.S.A. 97:2241‐2246.
   Bramlage, B., Luzi, E., and Eckstein, F. 1998. Designing ribozymes for the inhibition of gene expression. Trends Biotech. 16:434‐438.
   Branch, A.D. 1998. A good antisense molecule is hard to find. Trends Biochem. Sci. 23:45‐50.
   Brent, R. and Ptashne, M. 1985. A eukaryotic transcriptional activator bearing the DNA specificity of a prokaryotic repressor. Cell 43:729‐736.
   Cadwell, R.C. and Joyce, G.F. 1994. Mutagenic PCR. PCR Methods Appl. 3:S136‐S140.
   Caponigro, G., Abedi, M.R., Hurlburt, A.P., Maxfield, A., Judd, W., and Kamb, A. 1998. Transdominant genetic analysis of a growth control pathway. Proc. Natl. Acad. Sci. U.S.A. 95:7508‐7513.
   Chien, C.T., Bartel, P.L., Sternglanz, R., and Fields, S. 1991. The two‐hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. U.S.A. 88:9578‐9582.
   Cho, G., Keefe, A.D., Liu, R., Wilson, D.S., and Szostak, J.W. 2000. Constructing high complexity synthetic libraries of long ORFs using in vitro selection. J. Mol. Biol. 297:309‐391.
   Cohen, B. 1998. Selection of peptide aptamers that recognize and inhibit intracellular proteins. Ph.D. Thesis, Harvard University.
   Cohen, B.A., Colas, P., and Brent, R. 1998. An artificial cell‐cycle inhibitor isolated from a combinatorial library. Proc. Natl. Acad. Sci. U.S.A. 95:14272‐14277.
   Colas, P., Cohen, B., Jessen, T., Grishina, I., McCoy, J., and Brent, R. 1996. Genetic selection of peptide aptamers that recognize and inhibit cyclin‐dependent kinase 2. Nature 380:548‐550.
   Colas, P., Cohen, B., Ferrigno, P., Silver, P., and Brent, R. 2000. Targeted modification and transportation of cellular proteins. Proc. Natl. Acad. Sci. U.S.A. In press.
   Dalton, S. and Treisman, R. 1992. Characterization of SAP‐1, a protein recruited by serum response factor to the C‐FOS serum response element. Cell 68:597‐612.
   Davidson, A.R. and Sauer, R.T. 1994. Folded protein sequences occur frequently in libraries of random amino‐acid‐sequences. Proc. Natl. Acad. Sci. U.S.A. 91:2146‐2150.
   Durfee, T., Becherer, K., Chen, P.L., Yeh, S.H., Yang, Y., Kilburn, A.E., Lee, W.H. and Elledge, S.J. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555‐569.
   Ellington, A.D. and Szostak, J.W. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818‐822.
   Estojak, J., Brent, R., and Golemis, E.A. 1995. Correlation of two‐hybrid affinity data with in vitro measurements. Mol. Cell. Biol. 15:5820‐5829.
   Fabbrizio, E., Le Cam, L., Polanowski, J., Kaczorek, M., Lamb, N., Brent, R., and Sardet, C. 1999. Inhibition of mammalian cell proliferation by genetically selected peptide aptamers that functionally antagonize E2F activity. Oncogene 18:4357‐4363.
   Finley, R.L. Jr. and Brent, R. 1994. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc. Natl. Acad. Sci. U.S.A. 91:12980‐12984.
   Finley, R.L. and Brent, R. 1997. Understanding gene and allele function with two‐hybrid methods. Annu. Rev. Genet. 31:663‐704.
   Geyer, C.R. and Brent, R. 2000. Selection of “genetic” agents from random peptide aptamer expression libraries. Methods Enzymol. 328:171‐208.
   Geyer, C.R., Colman‐Lerner, A., and Brent, R. 1999. “Mutagenesis” by peptide aptamers identifies genetic network members and pathway connections. Proc. Natl. Acad. Sci. U.S.A. 96:8567‐8572.
   Gietz, R.D. and Schiestl, R.H. 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol 5:255‐269.
   Gorbsky, G.J., Chen, R.H. and Murray, A.W. 1998. Microinjection of antibody to Mad2 protein into mammalian cells in mitosis induces premature anaphase. J. Cell Biol. 141:1193‐1205.
   Gyuris, J., Golemis, E., Chertkov, H. and Brent, R. 1993. Cdi1,a human G1‐ and S‐phase protein phosphatase that associates with Cdk2. Cell 75:791‐803.
   Herskowitz, I. 1987. Functional inactivation of genes by dominant negative mutations. Nature 329:219‐222.
   Kamens, J. and Brent, R. 1991. A yeast transcription assay defines distinct REL and Dorsal DNA recognition sequences. New Biol. 3:1005‐1013.
   Katti, S.K., LeMaster, D.M. and Eklund, H. 1990. Crystal structure of thioredoxin from Escherichia coli at 1.68A resolution. J. Mol. Biol. 212:167‐184.
   Kolonin, M.G. and Finley, R.L. Jr. 1998. Targeting cyclin‐dependent kinases in Drosophila with peptide aptamers. Proc. Natl. Acad. Sci. U.S.A. 95:14266‐14271.
   Lam, K.S., Salmon, S.E., Hersch, E.N., Hruby, V.J., Katzmierski, W.M., and Knapp, R.J. 1991. A new type of synthetic peptide library for identifying ligand‐binding activity. Nature 354:82‐84.
   LaVallie, E.R., Diblasio, E.A., Kovacic., S., Grant, K.L., Schendel, P.F., and McCoy, J.M. 1993. A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm. Bio/Technology 11:187‐193.
   Lu, Z., Murray, K.S., Van Cleave, V., LaVallie, E.R., Stahl, M.L., and McCoy, J.M. 1995. Expression of thioredoxin random peptide libraries on the Escherichia‐Coli cell‐surface as functional fusions to flagellin – a system designed for exploring protein‐protein interactions. Biotechnology 13:366‐372.
   Mitchison, T.J. 1994. Towards a pharmacological genetics. Chem. Biol. 1:3‐6.
   Neuner, P., Cortese, R., and Monaci, P. 1998. Codon‐based mutagenesis using dimer‐phosphoramidites. Nucl. Acids Res. 26:1223‐1227.
   Norman, T.C., Smith, D.L., Sorger, P.K., Drees, B.L., O'Rourke, S.M., Hughes, T.R., Roberts, C.J., Friend, S.H., Fields, S., and Murray, A.W. 1999. Genetic selection of peptide inhibitors of biological pathways. Science 285:591‐595.
   Scott, J.K. and Smith, G.P. 1990. Searching for peptide ligands with an epitope library Science 249:386‐390.
   Sidhu, S.S. and Weiss, G.A. 2000. Constructing phage display libraries by oligonucleotide‐directed mutagenesis. In Phage Display: A Practical Approach (T. Clackson and H.B. Lowman eds.) In press. Oxford University Press, Oxford.
   Thomas, M., Chedin, S., Carles, C., Riva, M., Famulaok, M., and Sentenac, A. 1997. Selective targeting and inhibition of yeast RNA polymerase II by RNA aptamers. J. Biol. Chem. 272:27980‐27986.
   Virnekas, B., Ge, L., Pluckthun, A., Schneider, K.C., Wellnhofer, G., and Moroney, S.E. 1994. Trinucleotide phosphoramidites–Ideal reagents for the synthesis of mixed oligonucleotides for random mutagenesis. Nucl. Acids Res. 23:5600‐5607.
   Vojtek, A.B., Hollenberg, S.M., and Cooper, J.A. 1993. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74:205‐214.
   West, R.W. Jr., Yocum, R.R. and Ptashne, M. 1984. Saccharomyces cerevisiae GAL1‐GAL10 divergent promoter region: Location and function of the upstream activator sequence UASG. Mol. Cell. Biol. 4:2467‐2478.
   Wetterauer, B., Veron, M., Miginiac‐Maslow, M., Decottignies, P., and Jacquot, J.P. 1992. Biochemical characterization of thioredoxin‐1 from Dictyostelium discoideum. Eur. J. Biochem. 209:643‐649.
   Xu, C.W., Mendelsohn, A. and Brent, R. 1997. Cells that register logical relationships among proteins. Proc. Natl. Acad. Sci. U.S.A. 94:12473‐12478.
   Yang, M., Wu, Z., and Fields, S. 1995. Protein‐peptide interactions analyzed with the yeast two‐hybrid system. Nucl. Acids Res. 23:1152‐1156.
   Yocum, R.R., Hanley, S., West, R.J., and Ptashne, M. 1984. Use of LacZ fusions to delimit regulatory elements of the inducible divergent GAL1‐GAL10 promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 4:1985‐1998.
Key References
   Colas et al., 1996. See above.
  First article to describe the interaction trap as a method to isolate thioredoxin peptide aptamers against a specific protein (Cdk2).
   Geyer et al., 1999. See above.
  Describes the use of thioredoxin peptide aptamers for the forward analysis of the pheromone response pathway in yeast. Peptide aptamers were isolated that disrupt the pathway. Peptide aptamer targets were identified using mating interaction assays that contained panels of known proteins and by using interaction trap hunts against a yeast genomic library.
   Gyuris et al., 1993. See above.
  Initial description of the interaction trap.
   Finley and Brent, 1994. See above.
  Initial description of the mating interaction assay.
   Kolonin and Finley, 1998. See above.
  Describes the reverse analysis of a cellular process in Drosophila using peptide aptamers that bind to Drosophila Cdks.
   Lu et al., 1995. See above.
  First study to use E. coli thioredoxin as a scaffold for displaying combinatorial libraries of peptides.
   Norman et al., 1999. See above.
  Describes the use of staphylococcal nuclease peptide aptamers for the forward analysis of the yeast pheromone response and the spindle checkpoint signal transduction pathways. Peptide aptamers are characterized by transcript arrays and by two‐hybrid analysis using a protein panel containing almost all of the proteins in the yeast genome.
   Sidhu and Weiss, 2000. See above.
  Review article that describes strategies for designing combinatorial peptide libraries and efficient methods for transforming E. coli.
Internet Resources
   http://www.umanitoba.ca/faculties/medicine/units/biochem/gietz/Trafo.html
  Web site that describes efficient protocols for transforming yeast.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library