Representational Difference Analysis

Yuan Chang1

1 Hillman Cancer Center University of Pittsburgh, Pittsburgh, Pennsylvania
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 25B.7
DOI:  10.1002/0471142727.mb25b07s60
Online Posting Date:  November, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Representational difference analysis (RDA) couples subtractive hybridization to PCR‐mediated kinetic enrichment for the detection of differences between two complex genomes. In this unit, protocols start with the restriction digestion of two comparison DNA samples. Specific linkers are ligated to fragments from each pool and amplicons are generated by PCR. Linkers are removed from both samples and a new linker is added only to size‐selected tester amplicons. These tester amplicons are mixed with a large excess of driver amplicons lacking linkers. Hybridization results in three species of dsDNA fragments: (1) both strands derived from driver DNA (lacking linkers on either strand), (2) hybrids with one strand from driver (no linker) and one from tester (with linker), and (3) both strands from tester DNA (linkers on both strands). Excess driver removes DNA fragments common to both samples, and only the DNA fragments unique to the tester are amplified with linker‐specific primers.Representational difference analysis (RDA) couples subtractive hybridization to PCR‐mediated kinetic enrichment for the detect Representational difference analysis (RDA) couples subtractive hybridization to PCR‐mediated kinetic enrichment for the detect

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Genomic Representational Difference Analysis
  • Basic Protocol 2: cDNA Representational Difference Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Genomic Representational Difference Analysis

  Materials
  • Tester and driver DNA samples
  • Phenol (Amresco; unit 2.1)
  • Phenol:chloroform:isoamyl alcohol (Amresco; unit 2.1)
  • 20 µg/µl glycogen
  • TE buffer, pH 8.0 ( appendix 22)
  • Primers/oligomers, HPLC purified (Table 25.7.1)
    Table 5.0.1   MaterialsPrototypic Primers Used in RDA

    Primer Type Name a Sequence b
    Representation
    24‐mers RBgl24 5′‐AGCACTCTCCAGCCTCTCACCGCA‐3′
    RBam24 5′‐AGCACTCTCCAGCCTCTCACCGAG‐3′
    RHind24 5′‐AGCACTCTCCAGCCTCTCACCGCA‐3′
    RXxx24 5′‐AGCACTCTCCAGCCTCTCACCGxx‐3′
    12‐mers RBgl12 5′‐GATCTGCGGTGA‐3′
    RBam12 5′‐GATCCTCGGTGA‐3′
    RHind12 5′‐AGCTTGCGGTGA‐3′
    RXxx24 5′‐xxxxxx  CGGTGA‐3′
    Odd cycle
    24‐mers OBgl24 5′‐ACCGACGTCGACTATCCATGAACA‐3′
    OBam24 5′‐ACCGACGTCGACTATCCATGAACG‐3′
    OHind24 5′‐ACCGACGTCGACTATCCATGAACA‐3′
    OXxx24 5′‐ACCGACGTCGACTATCCATGAACx‐3′
    12‐mers OBgl12 5′‐GATCTGTTCATG‐3′
    OBam12 5′‐GATCCGTTCATG‐3′
    OHind12 5′‐AGCTTGTTCATG‐3′
    OXxx24 5′‐xxxxx GTTCATG‐3′
    Even cycle
    24‐mers EBgl24 5′‐AGGCAACTGTGCTATCCGAGGGAA‐3′
    EBam24 5′‐AGGCAACTGTGCTATCCGAGGGAG‐3′
    EHind24 5′‐AGGCAGCTGTGGTATCGAGGGAGA‐3′
    EXxx24 5′‐AGGCAACTGTGCTATCCGAGGGAx‐3′
    12‐mers EBgl12 5′‐GATCTTCCCTCG‐3′
    EBam12 5′‐GATCCTCCCTCG‐3′
    EHind12 5′‐AGCTTCTCCCTC‐3′
    EXxx12 5′‐xxxxx TCCCTCG‐3′

     aR primers are used only in making representations of the tester and driver DNAs. The O and E primers are used in odd and even iterations of the subtractive/enrichment process. These were previously designated J and N in the original protocol (Lisitsyn et al., ).
     bUnderscores indicate restriction sites that are variable, but limited to those comprising restriction sites (i.e., can be changed to accommodate other enzymes). Nucleotides shown in bold outline invariant core sequences of the primers. Nucleotides which are neither bold nor underscored are completely variable.
  • 400 U/µl T4 DNA ligase and 10× buffer (New England BioLabs; unit 3.14)
  • recipe5× RDA PCR buffer (see recipe)
  • dNTP chase solution: 4 mM (each) dGTP, dATP, dTTP, dCTP; store at −20°C
  • 5 U/µl Taq DNA polymerase (Invitrogen; unit 3.5)
  • Mineral oil
  • Isopropanol
  • 10 M ammonium acetate ( appendix 22)
  • 100% ethanol, ice cold
  • 70% ethanol, room temperature
  • 3 M sodium acetate, pH 5.2 ( appendix 22)
  • recipeEE × 3 hybridization buffer (see recipe)
  • 5 M NaCl
  • 5 µg/µl glycogen in TE buffer (see appendix 22 for TE buffer)
  • 10 U/µl mung bean nuclease and 10× buffer (New England BioLabs; unit 3.12)
  • 50 mM Tris⋅Cl, pH 8.9 ( appendix 22)
  • Thermal Cycler (Perkin‐Elmer Model 480 preferred)
  • 24‐mm GF/C glass microfibre filters (Whatman)
  • Dialysis tubing, 6,000 to 8,000 MWCO (Spectra/Pore)
  • Flat blunt forceps
  • 18‐G needle
  • Additional reagents and equipment for restriction digestion (unit 3.1), agarose gel electrophoresis (unit 2.5), ethanol and isopropanol precipitation (unit 2.1), and quantifying DNA by absorbance spectroscopy ( appendix 3D), gel isolation (unit 2.6), and sequencing (unit 7.1).
NOTE: Use de‐ionized, distilled water in all recipes and protocol steps, and ensure that the water is RNase/DNase free. Since minute amounts of contaminating DNA may be detected by RDA, use barrier pipet tips throughout the protocol.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bakin, A.V. and Curran, T. 1999. Role of DNA 5‐methylcytosine transferase in cell transformation by fos. Science 283:387‐390.
   Birkenmeyer, L.G., Desai, S.M., Muerhoff, A.S., Leary, T.P., Simons, J.N., Montes, C.C., and Mushahwar, I.K. 1998. Isolation of a GB virus‐related genome from a chimpanzee. J. Med. Virol. 56:44‐51.
   Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. 1994. Identification of herpesvirus‐like DNA sequences in AIDS‐associated Kaposi's sarcoma. Science 266:1865‐1869.
   Geng, M., Wallrapp, C., Muller‐Pillasch, F., Frohme, M., Hoheisel, J.D., and Gress, T.M. 1998. Isolation of differentially expressed genes by combining representational difference analysis (RDA) and cDNA library arrays. Biotechniques 25:434‐438.
   Hubank, M. and Schatz, D.G. 1994. Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 22:5640‐5648.
   Lisitsyn, N. and Wigler, M. 1995. Representational difference analysis in detection of genetic lesions in cancer. Methods Enzymol. 254:291‐304.
   Lisitsyn, N., Lisitsyn, N., and Wigler, M. 1993. Cloning the differences between two complex genomes. Science 259:946‐951.
   Lowrey, P.L., Shimomura, K., Antoch, M.P., Yamazaki, S., Zemenides, P.D., Ralph, M.R., Menaker, M., and Takahashi, J.S. 2000. Positional syntenic cloning and functional characterization of the mammalian circadian mutation tau. Science 288:483‐492.
   Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y., and Mayumi, M. 1997. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem. Biophys. Res. Commun. 241:92‐97.
   O'Neill, M.J. and Sinclair, A.H. 1997. Isolation of rare transcripts by representational difference analysis. Nucleic Acids Res. 25:2681‐2682.
   Pastorian, K., Hawel, L. 3rd, and Byus, C.V. 2000. Optimization of cDNA representational difference analysis for the identification of differentially expressed mRNAs. Anal. Biochem. 283:89‐98.
   Reick, M., Garcia, J.A., Dudley, C., and McKnight, S.L. 2001. NPAS2: An analog of clock operative in the mammalian forebrain. Science 293:506‐509.
   Shields, J.M., Der, C.J., and Powers, S. 2001. Identification of Ras‐regulated genes by representational difference analysis. Methods Enzymol. 332:221‐232.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library