Quantification of Gene Transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) Using 1 to 2 µg Total RNA

Danos C. Christodoulou1, Joshua M. Gorham1, Masataka Kawana1, Steven R. DePalma1, Daniel S. Herman1, Hiroko Wakimoto1

1 Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 25B.9
DOI:  10.1002/0471142727.mb25b09s93
Online Posting Date:  January, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Deep sequencing analysis of gene expression (DSAGE) measures global gene transcript levels from only 1 to 2 µg total RNA by massively parallel sequencing of cDNA tags. This unit describes the construction of 21‐bp cDNA tag libraries appropriate for massively parallel sequencing and analysis of the resulting sequence data. The adapter oligonucleotides used are optimized for sequencing with current Illumina massively parallel sequencers, and a step‐by‐step implementation of the analysis protocol is described. The expression profiles obtained are highly reproducible, enabling sensitive detection of differences between experimental conditions as well as assessment of the relative transcript abundance of different genes. Curr. Protoc. Mol. Biol. 93:25B.9.1‐25B.9.16. © 2011 by John Wiley & Sons, Inc.

Keywords: digital gene expression; serial analysis of gene expression (SAGE); gene expression profiling; high‐throughput sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: DSAGE Library Construction
  • Basic Protocol 2: Generation and Comparison of Gene Expression Profiles
  • Alternate Protocol 1: Automated Generation of Expression Profiles for Multiple Samples
  • Support Protocol 1: Generation of Gene‐Based Annotation Tables from Expanded Transcript Tables
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: DSAGE Library Construction

  Materials
  • Dynabeads mRNA DIRECT Kit (Invitrogen, cat. #610‐12), including oligo(dT) beads, lysis buffer, buffer A, and buffer B
  • High‐quality RNA, optionally from three to five sample replicates, extracted using RNAeasy kit (Qiagen, cat. #74104) or standard protocol using Trizol (Invitrogen, cat. #15596‐018)
  • SuperScript II reverse transcriptase (Invitrogen, cat. #18064‐022), including First Strand Buffer, DTT, and 10 mM dNTPs
  • Second‐Strand Buffer (Invitrogen, cat. #10812‐014)
  • E. coli DNA polymerase I (Invitrogen, cat. #18010025)
  • E. coli DNA ligase (Invitrogen, cat. #18052019)
  • E. coli RNase H (Invitrogen, cat. #18021071)
  • Buffers C, D, and E (see reciperecipes)
  • LoTE buffer (see recipe)
  • 100× BSA (New England Biolabs, cat. #B9001S)
  • NEBuffer 4 (New England Biolabs, cat. #B7004S)
  • 0.5 M EDTA, pH 8.0 ( appendix 22)
  • NlaIII (New England Biolabs, cat. #R0125L)
  • Adapters 1 and 2 (see recipe)
  • T4 DNA ligase, high concentration, with ligase buffer (Invitrogen, cat. #15224‐041)
  • MmeI (New England Biolabs, cat. #R0637L) with S‐adenosylmethionine (SAM)
  • Phenol/chloroform (Ambion, cat. #AM9732), adjusted to pH 7.5‐8
  • GlycoBlue (Ambion, cat. #AM9515)
  • 7.5 M ammonium acetate ( appendix 22)
  • 100% ethanol
  • 10× BlueJuice gel loading buffer (Invitrogen, cat. #10816‐015)
  • Novex 20% TBE gels (Invitrogen, cat. #EC6315BOX)
  • Low‐molecular‐weight DNA ladder (New England Biolabs, cat. #N3233S)
  • SYBR Green I (Invitrogen, cat. #S7563)
  • Glycogen (Roche, cat. #10901393001)
  • MGB buffer (see recipe)
  • Dimethyl sulfoxide (DMSO)
  • 10 mM dNTP mix
  • 100 µM GexPCR primers A and B (Integrated DNA Technologies):
    • 5′‐CAAGCAGAAGACGGCATACGA
    • 5′‐AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
  • Platinum Taq DNA polymerase (Invitrogen, cat. #10966034)
  • Quant‐iT dsDNA HS Assay Kit (Invitrogen, cat. #Q32851)
  • 0.5‐ and 1.5‐ml non‐stick RNase‐free microcentrifuge tubes (Ambion, cat. #12350 and 12450)
  • DynaMag‐2 magnet (Invitrogen, cat. #123‐21D)
  • 16°C water bath
  • 50° and 60°C heating blocks
  • UV light source
  • 18‐G needle
  • Spin‐X centrifuge tube filters (Corning, cat. #8161)
  • Thermocycler
  • Qubit fluorometer (Invitrogen, cat. #Q32857)
  • Additional reagents and equipment for polyacrylamide (unit 2.7) and agarose (unit 2.5) gel electrophoresis

Basic Protocol 2: Generation and Comparison of Gene Expression Profiles

  Materials
  • Software pre‐requisites (if using versions other than indicated, test for compatibility):
    • Bowtie 0.12.6
    • Samtools 0.1.11
    • Tophat 1.1.4
    • BioPerl‐1.6.1
    • Bio‐SamTools 1.24
    • Perl v5.10.0
    • BioPerl module for SAGE comparison
    • Integrative Genomics Viewer
  • Analysis software package includes:
    • Analysis programs written in Perl
    • Reference files
  • Software package requires a Unix‐based computer; a computing cluster is strongly recommended (run time ∼1‐2 hr using a 2.4‐GHz computing node)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Audic, S. and Claverie, J.M. 1997. The significance of digital gene expression profiles. Genome Res. 7:986‐995.
   Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., et al. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53‐59.
   Draghici, S., Khatri, P., Eklund, A.C., and Szallasi, Z. 2006. Reliability and reproducibility issues in DNA microarray measurements. Trends Genet. 22:101‐109.
   Karolchik, D., Hinrichs, A.S., Furey, T.S., Roskin, K.M., Sugnet, C.W., Haussler, D., and Kent, W.J. 2004. The UCSC Table Browser data retrieval tool. Nucleic Acids Res. 32:D493‐D496.
   Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., and Haussler, D. 2002. The human genome browser at UCSC. Genome Res. 12:996‐1006.
   Kim, J.B., Porreca, G.J., Song, L., Greenway, S.C., Gorham, J.M., Church, G.M., Seidman, C.E., and Seidman, J.G. 2007. Polony multiplex analysis of gene expression (PMAGE) in mouse hypertrophic cardiomyopathy. Science 316:1481‐1484.
   Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biol. 10:R25.
   Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R.; 1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078‐2079.
   Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., and Ragg, T. 2006. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 7:3.
   Trapnell, C., Pachter, L., and Salzberg, S.L. 2009. TopHat: Discovering splice junctions with RNA‐Seq. Bioinformatics 25:1105‐1111.
   Velculescu, V.E., Zhang, L., Vogelstein, B., and Kinzler, K.W. 1995. Serial analysis of gene expression. Science 270:484‐487.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library