RNA Interference in Caenorhabditis elegans

Darryl Conte1, Lesley T. MacNeil2, Albertha J.M. Walhout2, Craig C. Mello3

1 RNA Therapeutics Institute and Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts, 2 Programs in Systems Biology and Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts, 3 Howard Hughes Medical Institute, Chevy Chase, Maryland
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 26.3
DOI:  10.1002/0471142727.mb2603s109
Online Posting Date:  January, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

RNAi has become an essential tool in C. elegans research. This unit describes procedures for RNAi in C. elegans by microinjecting with dsRNA, feeding with bacteria expressing dsRNA, and soaking in dsRNA solution, as well as high‐throughput methods for RNAi‐based screens. © 2015 by John Wiley & Sons, Inc.

Keywords: RNAi; microinjection; feeding; soaking; high‐throughput screening assays; C. elegans

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Microinjecting Worms with dsRNA
  • Alternate Protocol 1: Microinjection into unc‐42 rde‐1 Animals Crossed to N2 Males to Examine Zygotic RNAi Phenotypes
  • Basic Protocol 2: Feeding Worms dsRNA
  • Basic Protocol 3: RNAi by Feeding IN 96‐Well Agar Plates
  • Alternate Protocol 2: Screening IN 24‐Well Agar Plates
  • Basic Protocol 4: RNAi in 96‐Well Liquid Culture
  • Basic Protocol 5: Soaking Worms in dsRNA
  • Support Protocol 1: Picking and Propagating C. elegans
  • Support Protocol 2: Sexing and Mating C. elegans
  • Support Protocol 3: Collection of C. elegans Eggs by Hypochlorite Treatment
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Microinjecting Worms with dsRNA

  Materials
  • 0.1 to 1 μg/μl dsRNA
  • Halocarbon oil Series 700 (Halocarbon Products)
  • L4 to young‐adult staged C. elegans (e.g., strain N2; CGC)
  • M9 buffer (see recipe)
  • NGM plates seeded with E. coli (see recipe)
  • Loading capillary (see recipe)
  • Microinjection needle (see recipe)
  • Inverted microscope (Nikon) with micromanipulator and microinjection assembly with N 2 gas supply (e.g., TRITECH Research Microinjector System)
  • Agarose microinjection pads (see recipe)
  • 30‐mm Petri dish lid
  • Dissecting microscope
  • Platinum wire pick flattened at the end
  • Additional reagents and materials for transferring and propagating C. elegans (see protocol 8)

Alternate Protocol 1: Microinjection into unc‐42 rde‐1 Animals Crossed to N2 Males to Examine Zygotic RNAi Phenotypes

  Additional Materials (also see protocol 1)
  • Male N2 C. elegans (CGC)
  • unc‐42 rde‐1 C. elegans (WM36; CGC)
  • Mating plates (see recipe)
  • Additional reagents and equipment for transferring and propagating (see protocol 8), and mating C. elegans ( protocol 9)

Basic Protocol 2: Feeding Worms dsRNA

  Materials
  • cDNA
  • L4440 double T7 RNAi feeding vector (Fig.  ; Addgene)
  • E. coli RNAi feeding strain HT115(DE3) (CGC)
  • Terrific broth (TB; unit 1.1; Elbing and Brent, ) containing 50 μg/ml each ampicillin and tetracycline (unit 1.4; Raleigh et al., )
  • TB containing 50 μg/ml ampicillin
  • M9 buffer (see recipe)
  • M9 buffer with 15% (v/v) glycerol (see recipe)
  • NGM/amp/IPTG plates (see recipe)
  • Gravid/young adult, L1 larvae, or L4 larvae C. elegans of appropriate strain(s) (e.g., N2, CGC)
  • NGM/amp/IPTG plates (see recipe) seeded with HT115 containing empty L4440 RNAi feeding vector
  • Additional reagents and equipment for subcloning DNA fragments (unit 3.16; Struhl, ), transforming E. coli (unit 1.8; Seidman et al., ), growing E. coli (unit 1.2; Elbing and Brent, ), and transferring and propagating C. elegans (see protocol 8)
NOTE: Perform each RNAi experiment in triplicate.

Basic Protocol 3: RNAi by Feeding IN 96‐Well Agar Plates

  Materials
  • Eggs or L1‐stage C. elegans
  • NGM liquid medium and 10‐cm agar plates (see recipe)
  • Ampicillin (or carbenicillin)
  • Isopropyl β‐D‐1‐thiogalactopyranoside (IPTG)
  • LB liquid medium (unit 1.1; Elbing and Brent, )
  • Tetracycline
  • RNAi library frozen at −80°C (Source Bioscience or GE Dharmacon; see Internet Resources)
  • M9 buffer (see recipe)
  • LB plates containing 50 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • Primers for PCR: RNAiRv:TGGATAACCGTATTACCGCC and RNAiFw: GTTTTCCCAGTCACGACGTT
  • 60°C water bath
  • Large‐volume reservoirs for dispensing media (purchased or home‐made using autoclaved micropipet tip boxes)
  • Flat‐bottom 96‐well plates
  • 96‐well deep‐well plates (2 ml/well)
  • Vibrating platform or shaking incubator
  • Liquid handling system or 96‐channel pipetting system (optional)
  • Aluminum plate sealers for frozen stocks
  • Breathable lids, such as Airpore tape sheets (Qiagen)
  • Zip‐lock bags
  • 50‐ml reagent reservoirs for eggs and L1s
  • Dissecting microscope
  • Additional reagents and equipment for spectrophotometric determination of bacterial density by A 600 (unit 1.2; Elbing and Brent, ), collecting C. elegans eggs by hypochlorite bleaching ( protocol 10), and the polymerase chain reaction (PCR, unit 15.1; Kramer and Coen, )

Alternate Protocol 2: Screening IN 24‐Well Agar Plates

  Additional Materials (see also protocol 4)
  • 24‐well plates
  • Wheaton Unispence dispenser
  • 3‐mm tubing
  • 12‐channel pipettor

Basic Protocol 4: RNAi in 96‐Well Liquid Culture

  Materials
  • RNAi library frozen at −80°C (Source Bioscience or GE Dharmacon; see Internet Resources)
  • Isopropyl β‐D‐1‐thiogalactopyranoside (IPTG)
  • NGM liquid medium and 10‐cm agar plates (see recipe)
  • Ampicillin (or carbenicillin)
  • L1‐stage C. elegans or eggs
  • M9 buffer (see recipe)
  • Centrifuge
  • 96‐well flat‐bottom plates
  • Breathable lids, such as Airpore tape sheets (Qiagen)
  • Additional reagents and equipment for preparing bacteria from library ( protocol 4, steps 3 to 6)

Basic Protocol 5: Soaking Worms in dsRNA

  Materials
  • dsRNA
  • Nonspecific dsRNA—i.e., dsRNA that is nonhomologous to any C. elegans sequence and which is comparable in length to the experimental dsRNA (e.g., gfp; optional)
  • Soaking solution (see recipe)
  • C. elegans (e.g., N2, CGC)
  • M9 buffer (see recipe)
  • NGM plates (see recipe) with and without seeded E. coli OP50 (see recipe)
  • 65°C water bath
  • 0.2‐ and 2.0‐ml microcentrifuge tubes
  • 5‐ml glass pipet
  • Additional reagents and equipment for ethanol precipitation (unit 2.1; Moore and Dowhan, )

Support Protocol 1: Picking and Propagating C. elegans

  Materials
  • 10‐cm plates with gravid adult worms ( protocol 4)
  • Buffered bleach, prepared fresh (see recipe)
  • M9 buffer (see recipe)
  • 15‐ml conical centrifuge tubes (e.g., BD Falcon)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Ashrafi, K., Chang, F.Y., Watts, J.L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Ruvkun, G. 2003. Genome‐wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421:268‐272.
  Baulcombe, D. 2003. Overview of RNA interference and related processes. Curr. Protoc. Mol. Biol. 62:26.1.1‐26.1.6.
  Bei, Y., Hogan, J., Berkowitz, L.A., Soto, M., Rocheleau, C.E., Pang, K.M., Collins, J., and Mello, C.C. 2002. SRC‐1 and Wnt signaling act together to specify endoderm and to control cleavage orientation in early C. elegans embryos. Dev. Cell 3:113‐125.
  Bosher, J.M. and Labouesse, M. 2000. RNA interference: Genetic wand and genetic watchdog. Nat. Cell. Biol. 2:E31‐E36.
  Byrne, A.B. Weirauch, M.T., Wong, V., Koeva, M, Dixon, S.J., Stuart, J.M., and Roy, P.J. 2007. A global analysis of genetic interactions in Caenorhabditis elegans. J. Biol. 6:8.
  Caldwell, G.A., Williams, S.N., and Caldwell, K.A. 2006. Integrated Genomics: A Discovery‐Based Laboratory Course. Wiley, New York.
  Calixto, A., Chelur, D. Topalidou, I, Chen, X., Chalfie, M. 2010. Enhanced neuronal RNAi in C. elegans using SID‐1. Nat. Methods 7:554‐559.
  Cipriani, P.G. and Piano, F. 2011. RNAi methods and screening: RNAi based high‐throughput genetic interaction screening. Methods Cell Biol. 106:89‐111.
  Dickinson, D.J., Ward, J.D., Reiner, D.J., and Goldstein, B. 2013. Engineering the Caenorhabditis elegans genome using Cas9‐triggered homologous recombination. Nat. Methods 10:1028‐1034.
  Dudley, N.R., Labbe, J.C., and Goldstein, B. 2002. Using RNA interference to identify genes required for RNA interference. Proc. Natl. Acad. Sci. U.S.A. 99:4191‐4196.
  Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. 2001. Duplexes of 21‐nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494‐498.
  Elbing, K. and Brent, R. 2002a. Growth in liquid media. Curr. Protoc. Mol. Biol. 59:I:1.2:1.2.1–1.2.2.
  Elbing, K. and Brent, R. 2002b. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1–1.1.7.
  Espelt, M.V., Extevez, A.Y., Yin, X., Strange, K. 2005. Oscillatory Ca2+ signaling in the isolated Caenorhabditis elegans intestine: Role of the inositol‐1,4,5‐triphosphate receptor and phospholipases C beta and gamma. J. Gen. Physiol. 126:379‐392.
  Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. 1998. Potent and specific genetic interference by double‐stranded RNA in Caenorhabditis elegans. Nature 391:806‐811.
  Firnhaber, C. and Hammarlund, M. 2013. Neuron‐specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function. PLoS Genet. 9:e1003921.
  Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez‐Campos, M., Sohrmann, M., and Ahringer, J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408:325‐330.
  Friedland, A.E., Tzur, Y.B. Exvelt, K.M., Colaiacovo, M.P., Church, G.M., and Calarco, J.A. 2013. Heritable genome editing in C. elegans via a CRISPR‐Cas9 system. Nat. Methods 10:741‐743.
  Gonczy, P., Echeverri, C., Oegema, K., Coulson, A., Jones, S.J., Copley, R.R., Duperon, J., Oegema, J., Brehm, M., Cassin, E., Hannak, E., Kirkham, M., Pichler, S., Flohrs, K., Goessen, A., Leidel, S., Alleaume, A.M., Martin, C., Ozlu, N., Bork, P., and Hyman, A.A. 2000. Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408:331‐336.
  Grishok, A., Tabara, H., and Mello, C.C. 2000. Genetic requirements for inheritance of RNAi in C. elegans. Science 287:2494‐2497.
  Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. 2001. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106:23‐34.
  Hannon, G.J. 2002. RNA interference. Nature 418:244‐251.
  Hope, I.A., ed. 1999. C. elegans: A Practical Approach. The Practical Approach Series. Oxford University Press, New York.
  Kamath, R.S., Martinez‐Campos, M., Zipperlen, P., Fraser, A.G., and Ahringer, J. 2001. Effectiveness of specific RNA‐mediated interference through ingested double‐stranded RNA in Caenorhabditis elegans. Genome Biol. 2:RESEARCH0002.
  Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., and Ahringer, J. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421:231‐237; comment 220‐221.
  Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte, D. Jr., Shirayama, M., and Mello, C.C. 2014. A Co‐CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197:1069‐1080.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Kurnit, D.M. 1994. Recombination‐based assay (RBA) for screening bacteriophage lambda libraries. Curr. Protoc. Mol. Biol. 27:6.12.1‐6.12.12.
  Lamesch, P., Milstein, S., Hao, T., Rosenberg, J., Li, N., Sequerra, R., Bosak, S., Doucette Stamm, L., Vandenhaute, J., Hill, D.E., and Vidal, M. 2004. C. elegans ORFeome version 3.1: Increasing the coverage of ORFeome resources with improved gene predictions. Genome Res. 14:2064‐2069.
  Lehner, B., Calixto, A., Crombie, C., Tischler, J., Fortunato, A., Chalfie, M., and Fraser, A.G. 2006a. Loss of LIN‐35, the Caenorhabditis elegans ortholog of the tumor suppressor p105Rb, results in enhanced RNA interference. Genome Biol. 7:R4.
  Lehner, B., Crombie, C., Tischler, J., Fortunato, A., and Fraser, A.G. 2006b. Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat. Genet. 38:896‐903.
  Lehner, B., Tischler, J., and Fraser, A.G. 2006c. RNAi screens in Caenorhabditis elegans in 96‐well liquid format and their application to the systematic identification of genetic interactions. Nat. Protoc. 1:1617‐1620.
  Maeda, I., Kohara, Y., Yamamoto, M., and Sugimoto, A. 2001. Large‐scale analysis of gene function in Caenorhabditis elegans by high‐throughput RNAi. Curr. Biol. 11:171‐176.
  Mello, C. and Fire, A. 1995. DNA transformation. Methods Cell. Biol. 48:451‐482.
  Min, K., Kang, J., and Lee, J. 2010. A modified feeding RNAi method for simultaneous knock‐down of more than one gene in Caenorhabditis elegans. Biotechniques 48:229‐232.
  Montgomery, M.K., Xu, S., and Fire, A. 1998. RNA as a target of double‐stranded RNA‐mediated genetic interference in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U.S.A. 95:15502‐1557.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1A.1.1–2.1A.10.
  Parrish, S., Fleenor, J., Xu, S., Mello, C., and Fire, A. 2000. Functional anatomy of a dsRNA trigger: Differential requirement for the two trigger strands in RNA interference. Mol. Cell 6:1077‐1087.
  Paschal, B.M., McReynolds, L.A., Noren, C.J. and Nichols, N.M. 2008. RNA polymerases. Curr. Protoc. Mol. Biol. 84:3.8.1‐3.8.8.
  Piano, F., Schetter, A.J., Mangone, M., Stein, L., and Kemphues, K.J. 2000. RNAi analysis of genes expressed in the ovary of Caenorhabditis elegans. Curr. Biol. 10:1619‐1622.
  Qadota, H., Inoue, M., Hikita, T., Koppen, M., Hardin, J.D., Amano, M., Moerman, D.G., and Kaibushi, K. 2007. Establishment of a tissue‐specific RNAi system in C. elegans. Gene 400:166‐173.
  Raleigh, E.A., Elbing, K., and Brent, R. 2002. Selected topics from classical bacterial genetics. Curr. Protoc. Mol. Biol. 59:1.4.1‐1.4.14.
  Reboul, J., Vaglio, P., Rual, J.F., Lamesch, P., Martinez, M., Armstrong, C.M., Li, S., Jacotot, L., Bertin, N., Janky, R., Moore, T., Hudson, J.R. Jr., Hartley, J.L., Brasch, M.A., Vandenhaute, J., Boulton, S., Endress, G.A., Jenna, S., Chevet, E., Papasotiropoulos, V., Tolias, P.P., Ptacek, J., Snyder, M., Huang, R., Chance, M.R., Lee, H., Doucette‐Stamm, L., Hill, D.E., and Vidal, M. 2003. C. elegans ORFeome version 1.1: Experimental verification of the genome annotation and resource for proteome‐scale protein expression. Nat. Genet. 34:35‐41.
  Riddle, D.L., Blumenthal, T., Meyer, B.J., and Priess, J.R. 1997. C. ELEGANS II. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York.
  Rohde, C.B. and Yanik, M.F. 2011. Subcellular in vivo time‐lapse imaging and optical manipulation of Caenorhabditis elegans in standard multiwell plates. Nat. Commun. 2:271.
  Rual, J.F., Ceron, J., Koreth, J., Hao, T., Nicot, A.S., Hirozane‐Kishikawa, T., Vandenhaute, J., Orkin, S.H., Hill, D.E., van den Heuvel, S., and Vidal, M. 2004. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome‐based RNAi library. Genome Res. 14:2162‐2168.
  Rual, J.F., Klitgord, N., and Achaz, G. 2007. Novel insights into RNAi off‐target effects using C. elegans paralogs. BMC Genomics 8:106.
  Schmitz, C., Kinge, P., and Hutter, H. 2007. Axon guidance genes identified in a large‐scale RNAi screen using the RNAi‐hypersensitive Caenorhabditis elegans strain nre‐1(hd20) lin‐ 5b(hd126). Proc. Natl. Acad. Sci. U.S.A. 104:834‐839.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8:1.8.1‐1.8.10.
  Simmer, F., Moorman, C., vander Linden, A.M., Kuijk, E., van der Berghe, P.V., Kamath, R.S., Fraser, A.G., Ahringer, J., and Plasterk, R.H. 2003. Genome‐wide RNAi of C. elegans using the hypersensitive rrf‐3 strain reveals novel gene functions. PLoS Biol. 1:E12.
  Sönnichsen, B., Koski, L.B., Walsh, A., Marschall, P., Neumann, B., Brehm, M., Alleaume, A.M., Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C., Khan, M., Lazik, S., Martin, C., Nitzsche, B., Ruer, M., Stamford, J., Winzi, M., Heinkel, R., Röder, M., Finell, J., Häntsch, H., Jones, S.J., Jones, M., Piano, F., Gunsalus, K.C., Oegema, K., Gönczy, P., Coulson, A., Hyman, A.A., and Echeverri, C.J. 2005. Full‐genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434:462‐469.
  Steirnagle, T. 2006. Maintenance of C. elegans. Wormbook Feb 11:1‐11. Available at http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html.
  Struhl, K. 1987. Subcloning of DNA Fragments. Curr. Protoc. Mol. Biol. 13:3.16.1‐3.16.2.
  Sulston, J.E. and Horvitz, H.R. 1977. Post‐embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56:110‐156.
  Sulston, J.E., Schierenberg, E., White, J.G., and Thomson, J.N. 1983. The embryonic lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100:64‐119.
  Tabara, H., Grishok, A., and Mello, C.C. 1998. RNAi in C. elegans: Soaking in the genome sequence. Science 282:430‐431.
  Tabara, H., Sarkissian, M., Kelly, W.G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., and Mello, C.C. 1999. The rde‐1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123‐132.
  Tavernarakis, N., Wang, S.L., Dorovkov, M., Ryazanov, A., and Driscoll, M. 2000. Heritable and inducible genetic interference by double‐stranded RNA encoded by transgenes. Nat. Genet. 24:180‐183.
  Timmons, L., Court, D.L., and Fire, A. 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263:103‐112.
  Voytas, D. 2001. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Watson, E., MacNeil, L.T., Arda, H.E., Zhu, L.J., and Walhout, A.J.M. 2013. Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response. Cell 153:253‐266.
  Wolfsberg, T.G. and Madden, T.L. 1999. Sequence similarity searching using the BLAST family of programs. Curr. Protoc. Mol. Biol. 46:19.3.1‐19.3.29.
  Wood, W.B. (ed.) 1988. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Key References
  Hope, 1999. See above.
  A very good source for general information on culturing and maintaining worms as well as a comprehensive microinjection protocol for germline transformation.
  Kamath et al., 2001. See above.
  This manuscript provides an in depth analysis of the RNAi by feeding technique as well as a comparison to RNAi by microinjection.
  Riddle et al., 1997. See above.
  C. ELEGANS II provides an extensive overview of worm biology.
  Wood, 1988. See above.
  The predecessor of C. ELEGANS II (Riddle et al., ). The Nematode is full of important information about the biology of C. elegans.
Internet Resources
  http://www.wormbase.org
  Wormbase is an essential tool for C. elegans biologists, and provides an abundance of useful information regarding the genome and biology of C. elegans. The curators at Wormbase have provided annotations of each of the predicted genes, including RNAi phenotypes and expression data as well as links to useful sites. The curators are constantly updating and upgrading the site.
  http://www.wormatlas.org
  Worm atlas is an online database featuring behavioral and structural anatomy of the worm, C. elegans.
  http://www.rnai.org
  The RNAi database is a searchable database of ovary or germline‐enriched genes by gene or by phenotype.
  http://c.elegans.tripod.com/RNAi.htm
  The RNAi@elegans.net page has many informative links for RNAi in C. elegans and other organisms.
  http://nematode.lab.nig.ac.jp/
  NEXTDB is an expression pattern database based on in situ hybridizations using expressed sequence tags.
  http://worfdb.dfci.harvard.edu
  Worm ORFeome DataBase (WorfDB) is a searchable database for C. elegans ORF clones.
  http://www.cbs.umn.edu/research/resources/cgc
  The Caenorhabditis Genetics Center (CGC), funded by the National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440), is the central repository for C. elegans strains and distributes strains at a minimal cost to researchers.
  http://www.lifesciences.sourcebioscience.com/clone‐products/non‐mammalian/c‐elegans/
  Source Bioscience sells ORFeome and RNAi reagents, including the genome‐wide RNAi feeding library and sub‐libraries.
  http://dharmacon.gelifesciences.com/gene‐expression‐cdnas‐orfs/non‐mammalian‐cdnas‐and‐orfs/c‐elegans
  GE Dharmacon provides ORFeome reagents, including the ORFeome RNAi feeding collection.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library