Protein Interaction Profile Sequencing (PIP‐seq)

Shawn W. Foley1, Brian D. Gregory1

1 Cell and Molecular Biology Graduate Program, University of Pennsylvania, Philadelphia, Pennsylvania
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 27.5
DOI:  10.1002/cpmb.21
Online Posting Date:  October, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Every eukaryotic RNA transcript undergoes extensive post‐transcriptional processing from the moment of transcription up through degradation. This regulation is performed by a distinct cohort of RNA‐binding proteins which recognize their target transcript by both its primary sequence and secondary structure. Here, we describe protein interaction profile sequencing (PIP‐seq), a technique that uses ribonuclease‐based footprinting followed by high‐throughput sequencing to globally assess both protein‐bound RNA sequences and RNA secondary structure. PIP‐seq utilizes single‐ and double‐stranded RNA‐specific nucleases in the absence of proteins to infer RNA secondary structure. These libraries are also compared to samples that undergo nuclease digestion in the presence of proteins in order to find enriched protein‐bound sequences. Combined, these four libraries provide a comprehensive, transcriptome‐wide view of RNA secondary structure and RNA protein interaction sites from a single experimental technique. © 2016 by John Wiley & Sons, Inc.

Keywords: protein interaction profile sequencing (PIP‐seq); RNA‐protein interactions; RNA secondary structure; structure‐specific ribonucleases

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Formaldehyde Cross‐Linking of Tissue
  • Basic Protocol 2: Protein Interaction Profiling
  • Basic Protocol 3: Strand‐Specific High‐Throughput Sequencing Library Preparation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Formaldehyde Cross‐Linking of Tissue

  Materials
  • Tissue sample
  • Cross‐linking buffer (see recipe)
  • 1 M Glycine (Sigma, cat. no. G8790)
  • Distilled water
  • Liquid N 2
  • 50 ml conical tubes
  • End‐over‐end rotator
  • Vacuum desiccator (Nalgene, cat. no. 5310–0250)
  • Vacuum line
  • Paper towels

Basic Protocol 2: Protein Interaction Profiling

  Materials
  • Formaldehyde cross‐linked tissue ( protocol 1)
  • Liquid N 2
  • RIP buffer (see recipe)
  • DNase solution (see recipe)
  • 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740)
  • 100% EtOH (Decon Labs, cat. no. 2716)
  • 70% EtOH
  • RNase ONE buffer (Promega, cat. no. M4261)
  • RNase ONE (Promega, cat. no. M4261)
  • RNase stop buffer, 16× (see recipe)
  • QIAzol (Qiagen, cat. no. 79306)
  • 10× RNA Structure Buffer (Life Technologies, cat. no. AM2275)
  • RNase V1 (Life Technologies, cat. no. AM2275)
  • Mortar and pestle
  • 1.7‐ml tubes
  • Plastic pestle
  • 1000‐ and 200‐μl pipet tips
  • 2.0‐ml tubes
  • Centrifuge
  • 37°C heat block
  • 65°C heat block
  • Vortex mixer

Basic Protocol 3: Strand‐Specific High‐Throughput Sequencing Library Preparation

  Materials
  • Protein interaction profile RNA ( protocol 2)
  • 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740)
  • Fragmentation Stop Solution (Life Technologies, cat. no. AM8740)
  • DEPC‐treated H 2O
  • 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510)
  • 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740)
  • 100% EtOH (Decon Labs, cat. no. 2716)
  • 80% EtOH
  • Ice
  • T4 DNA ligase buffer (NEB, cat. no. B0202S)
  • T4 polynucleotide kinase (NEB, cat. no. M0201S)
  • 10 mM ATP (Life Technologies, cat. no. AM8110G)
  • 10× TBE (Bio‐Rad, 161‐0733)
  • Gel loading buffer II (Life Technologies, cat. no. AM8546G)
  • 10‐bp DNA ladder (Life Technologies, cat. no. 10821‐015)
  • 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585‐011)
  • 0.3 M NaCl
  • 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG)
  • RNA Ligase Buffer (NEB, cat. no. B0216L)
  • RNaseOUT (Life Technologies, cat. no. 10777019)
  • 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S)
  • 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC)
  • T4 RNA Ligase 1 (NEB, cat. no. M0204S)
  • RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA)
  • 5× First‐Strand Buffer (Life Technologies, cat. no. 18064‐014)
  • 50 mM dNTPs
  • 100 mM DTT (Life Technologies, cat. no. 18064‐014)
  • SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064‐014)
  • 2× Phusion Mix (NEB, cat. no. M0531S)
  • 5 mM Betaine (MP Biomedicals, cat. no. 215046180)
  • 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA)
  • 10 μM RNA PCR Primer Index
  • Nuclease‐free water
  • 25‐bp DNA ladder (Life Technologies, cat. no. 10597‐011)
  • DSN Hybridization buffer (see recipe)
  • 10× DSN Master Mix (Evrogen, cat. no. EA001)
  • DSN Enzyme (Evrogen, cat. no. EA001)
  • DSN STOP solution (Evrogen, cat. no. EA001)
  • 1.7‐ml tubes
  • 70°C heat block
  • Centrifuge
  • 37°C heat block
  • 1.0‐mm, 10‐well 15% TBE‐Urea gels (Life Technologies, cat. no. EC6885BOX)
  • Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001)
  • 18‐G needles
  • Razor blades
  • Gel Breaker Tubes (IST Engineering, cat. no. 388‐100)
  • 2‐ml tubes
  • End‐over‐end rotator
  • Spin‐X columns (Costar, cat. no. 8160)
  • 200‐μl PCR tubes
  • Thermal cycler
  • 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Baltz, A.G., Munschauer, M., Schwanhausser, B., Vasile, A., Murakawa, Y., Schueler, M., Youngs, N., Penfold‐Brown, D., Drew, K., Milek, M., Wyler, E., Bonneau, R., Selbach, M., Dieterich, C., and Landthaler, M. 2012. The mRNA‐bound proteome and its global occupancy profile on protein‐coding transcripts. Mol. Cell 46:674‐690. doi: 10.1016/j.molcel.2012.05.021.
  Braunschweig, U., Gueroussov, S., Plocik, A.M., Graveley, B.R., and Blencowe, B.J. 2013. Dynamic integration of splicing within gene regulatory pathways. Cell 152:1252‐1269. doi: 10.1016/j.cell.2013.02.034.
  Ebert, M.S. and Sharp, P.A. 2012. Roles for MicroRNAs in conferring robustness to biological processes. Cell 149:515‐524. doi: 10.1016/j.cell.2012.04.005.
  Gosai, S.J., Foley, S.W., Wang, D., Silverman, I.M., Selamoglu, N., Nelson, A.D.L., Beilstein, M.A., Daldal, F., Deal, R.B., and Gregory, B.D. 2015. Global analysis of the RNA‐protein interaction and RNA secondary structure landscapes of the arabidopsis nucleus. Mol. Cell 57:376‐388. doi: 10.1016/j.molcel.2014.12.004.
  Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M. Jr, Jungkamp, A.C., Munschauer, M., Ulrich, A., Wardle, G.S., Dewell, S., Zavolan, M., and Tuschl, T. 2010. Transcriptome‐wide identification of RNA‐binding protein and microRNA target sites by PAR‐CLIP. Cell 141:129‐141. doi: 10.1016/j.cell.2010.03.009.
  Licatalosi, D.D., Mele, A., Fak, J.J., Ule, J., Kayikci, M., Chi, S.W., Clark, T.A., Schweitzer, A.C., Blume, J.E., Wang, X., Darnell, J.C., and Darnell, R.B. 2008. HITS‐CLIP yields genome‐wide insights into brain alternative RNA processing. Nature 456:464‐469. doi: 10.1038/nature07488.
  Silverman, I.M. and Gregory, B.D. 2015. Transcriptome‐wide ribonuclease‐mediated protein footprinting to identify RNA‐protein interaction sites. Methods 72:76‐85. doi: 10.1016/j.ymeth.2014.10.021.
  Silverman, I.M., Li, F., Alexander, A., Goff, L., Trapnell, C., Rinn, J.L., and Gregory, B.D. 2014. RNase‐mediated protein footprint sequencing reveals protein‐binding sites throughout the human transcriptome. Genome Biol. 15:R3. doi: 10.1186/gb‐2014‐15‐1‐r3.
  Ule, J., Jensen, K.B., Ruggiu, M., Mele, A., Ule, A., and Darnell, R.B. 2003. CLIP identifies nova‐regulated RNA networks in the brain. Science 302:1212‐1215. doi: 10.1126/science.1090095.
  Wan, Y., Kun Qu, K., Zhang, Q.C., Flynn, R.A., Manor, O., Ouyang, Z., Zhang, J., Spitale, R.C., Snyder, M.P., Segal, E., and Chang, H.Y. 2014. Landscape and variation of RNA secondary structure across the human transcriptome. Nature 505:706‐709. doi: 10.1038/nature12946.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library