CRISPR/Cas9‐Directed Genome Editing of Cultured Cells

Luhan Yang1, Joyce L. Yang2, Susan Byrne1, Joshua Pan2, George M. Church1

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, 2 Biological and Biomedical Sciences Program, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.1
DOI:  10.1002/0471142727.mb3101s107
Online Posting Date:  July, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Human genome engineering has been transformed by the introduction of the CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR‐associated) system found in most bacteria and archaea. Type II CRISPR/Cas systems have been engineered to induce RNA‐guided genome editing in human cells, where small RNAs function together with Cas9 nucleases for sequence‐specific cleavage of target sequences. Here we describe the protocol for Cas9‐mediated human genome engineering, including construct building and transfection methods necessary for delivering Cas9 and guide RNA (gRNA) into human‐induced pluripotent stem cells (hiPSCs) and HEK293 cells. Following genome editing, we also describe methods to assess genome editing efficiency using next‐generation sequencing and isolate monoclonal hiPSCs with the desired modifications for downstream applications. Curr. Protoc. Mol. Biol. 107:31.1.1‐31.1.17. © 2014 by John Wiley & Sons, Inc.

Keywords: genome engineering; CRISPR; human stem cells

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of Cas9 and gRNA Plasmids
  • Basic Protocol 2: Transfection of hiPSCs
  • Alternate Protocol 1: Transfection of Human HEK293 Cells
  • Basic Protocol 3: Genotyping Transfected Cells Using Next‐Generation Sequencing
  • Basic Protocol 4: Single‐Cell Isolation of Genome‐Targeted Monoclonal hiPSCs
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of Cas9 and gRNA Plasmids

  Materials
  • Cas9 plasmid (Addgene, plasmid ID 41815) as bacterial stab in agar
  • LB agar plate containing 100 µg/ml ampicillin (unit 1.1)
  • LB liquid medium containing 100 µg/ml ampicillin (unit 1.1)
  • HiSpeed Plasmid Maxi Kit (Qiagen)
  • PCR‐grade sterile deionized water
  • PCR‐Blunt II‐Topo kit (Invitrogen, cat. no. K2800‐20) including One Shot Top10 Chemically Competent E. coli cells (other competent cells for cloning may also be used)
  • Sterilized glass beads (EMD Millipore, cat. no. 71013‐3)
  • LB agar plate containing 50 µg/ml kanamycin (unit 1.1)
  • M13 Forward (5′‐GTTTTCCCAGTCACGACG‐3′) and M13 Reverse (5′‐AACAGCTATGACCATG‐3′) universal sequencing primers
  • LB liquid medium containing 50 µg/ml kanamycin (unit 1.1)
  • Qiagen plasmid Mini Kit (Qiagen)
  • Sterile pipet tips or toothpicks for picking colonies from agar plates
  • 37°C incubator‐shaker
  • Nanodrop microspectrophotometer (http://www.nanodrop.com)
  • Sequence analysis software (e.g., NCBI BLAST, UCSC Genome Browser BLAT, LaserGene)
  • DNA synthesis facility
  • 42°C incubator for heat‐shocking cells
  • 10‐ml bacterial culture tubes
  • Access to Sanger sequencing facility
  • Additional reagents and equipment for DNA synthesis (unit 2.11) and Sanger sequencing (unit 7.1)

Basic Protocol 2: Transfection of hiPSCs

  Materials
  • PGP1 hiPSC cells adapted for growth on Matrigel (see personal genome project Web site: http://www.personalgenomes.org/)
  • Matrigel (hESC‐qualified; BD Sciences, cat. no. 354277)
  • DMEM/F12 medium (Invitrogen)
  • mTeSR1 medium (StemCell Technologies, cat. no. 05850)
  • InSolution Rho kinase (ROCK) inhibitor (Calbiochem, cat. no. Y‐27632)
  • P3 Primary Cell 4D‐Nucleofector X kit containing P3 and Supplement 1 solutions in addition to 16‐well Nucleocuvette Strips (Lonza, cat. no. V4XP‐4032)
  • Cas9 plasmid DNA (see protocol 1)
  • gRNAexpression vector (see protocol 1)
  • Phosphate‐buffered saline (PBS; Life Technologies, cat. no. 20012‐050)
  • TrypLE Express (Invitrogen, cat. no. 12604‐013)
  • 6‐ and 48‐well tissue culture–treated plates
  • 15‐ and 50‐ml conical centrifuge tubes (e.g., BD Falcon)
  • Countess automated cell counter (Invitrogen)
  • Tabletop centrifuge and plate adapter
  • Amaxa 4D‐Nucleofector System (Lonza, cat. no. CD‐MN025)
  • Additional reagents and equipment for culture of hiPSC in mTeSR medium (see Technical Manual Version 3.0.0 from Stem Cell Technologies; http://www.stemcell.com/~/media/Technical%20Resources/B/C/A/2/B/29106MAN_3_0_0.pdf)

Alternate Protocol 1: Transfection of Human HEK293 Cells

  Additional Materials (also see protocol 2)
  • HEK 293 cells (Invitrogen)
  • Complete DMEM medium (see recipe)
  • Lipofectamine 20000 (Invitrogen, cat. no. 11668027)
  • Opti‐MEM medium (Invitrogen, cat. no. 31985062)
  • Cas9 plasmid DNA (see protocol 1)
  • gRNAexpression vector (see protocol 1)
  • 12‐well tissue culture treated plates

Basic Protocol 3: Genotyping Transfected Cells Using Next‐Generation Sequencing

  Materials
  • Illumina forward sequence (ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
  • Illumina reverse sequence (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
  • Transfected hiPSCs ( protocol 1 or protocol 3Alternate Protocol) growing in culture
  • Phosphate‐buffered saline (PBS; Life Technologies, cat. no. 20012‐050)
  • mTeSR1 medium (StemCell Technologies, cat. no. 05850)
  • prepGEM gold buffer (ZyGEM)
  • prepGEM tissue protease enzyme (ZyGEM)
  • KAPA Hifi Hotstart Readymix (KAPA Biosystems)
  • Illumina amplification primers (see step 3)
  • Illumina index primers (ScriptSeq Index PCR Primers)
  • Illumina PCR primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT)
  • 2‐log DNA ladder (New England Biolabs)
  • QIAquick PCR purification kit (Qiagen)
  • Computer running Primer3 software (http://primer3.sourceforge.net/) for primer identification
  • 15‐ml conical tubes (BD Falcon)
  • Tabletop centrifuge
  • Thermal cycler
  • Access to MiSeq sequencer
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5) and measuring DNA concentration ( appendix 3D)

Basic Protocol 4: Single‐Cell Isolation of Genome‐Targeted Monoclonal hiPSCs

  Materials
  • 0.1% (w/v) gelatin (StemCell Technologies, cat. no. 07903)
  • Irradiated CF‐1 mouse embryonic fibroblasts (Michalska, )
  • hES cell medium (see recipe)
  • Recombinant fibroblast growth factor (Millipore)
  • SMC4 (BD Biosciences; for 1× SMC4, supplement 500 ml of medium with one vial of SMC4 purchased from BD)
  • Fibronectin (StemCell Technologies)
  • Heterogenous pool of edited hiPSC ( protocol 2)
  • mTeSR1 medium (StemCell Technologies, cat. no. 05850) supplemented with SMC4 (BD Biosciences) at final concentration of 1× (one vial per 500 ml medium)
  • mTeSR1 medium (StemCell Technologies, cat. no. 05850), unsupplemented
  • Phosphate‐buffered saline (PBS; Invitrogen, cat. no. 20012‐050)
  • Accutase (Millipore)
  • ToPro‐3 viability dye (Invitrogen)
  • Matrigel (hESC‐qualified; BD Sciences, cat. no. 354277)
  • 96‐well plates
  • BD FACSAria II SORP UV (BD Biosciences) with 100‐mm nozzle
  • Centrifuge for 96‐well plates
  • Access to Sanger sequencing facility
  • Additional reagents and equipment for obtaining amplicons of the targeting region (see protocol 4, steps 4 to 11)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bhaya, D., Davison, M., and Barrangou, R. 2011. CRISPR‐Cas systems in bacteria and archaea: Versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genetics 45:273‐297.
  Brouns, S.J.J., Jore, M.M., Lundgren, M., Westra, E.R., Slijkhuis, R.J.H., Snijders, A.P.L., Dickman, M.J., Makarova, K.S., Koonin, E.V., and van der Oost, J. 2008. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960‐964.
  Carte, J., Wang, R., Li, H., Terns, R.M., and Terns, M. P. 2008. Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev. 22:3489‐3496.
  Chen, F., Pruett‐Miller, S.M., Huang, Y., Gjoka, M., Duda, K., Taunton, J., Collingwood, T.N., Frodin, M., and Davis, G.D. 2011. High‐frequency genome editing using ssDNA oligonucleotides with zinc‐finger nucleases. Nat. Methods 8:753‐755.
  Cho, S. W., Kim, S., Kim, J. M., and Kim, J.‐S. 2013. Targeted genome engineering in human cells with the Cas9 RNA‐guided endonuclease. Nat. Biotechnol. 31:230‐232.
  Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823.
  Deltcheva, E., Chylinski, K., Sharma, C.M., Gonzales, K., Chao, Y., Pirzada, Z.A., Eckert, M.R., Vogel, J., and Charpentier, E. 2011. CRISPR RNA maturation by trans‐encoded small RNA and host factor RNase III. Nature 471:602‐607.
  DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J., and Church, G.M. 2013. Genome engineering in Saccharomyces cerevisiae using CRISPR‐Cas systems. Nucleic Acids Res. 41:4336‐4343.
  Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiácovo, M.P., Church, G.M., and Calarco, J.A. 2013. Heritable genome editing in C. elegans via a CRISPR‐Cas9 system. Nat. Methods 10:741‐743.
  Gesner, E.M., Schellenberg, M.J., Garside, E.L., George, M.M., and Macmillan, A.M. 2011. Recognition and maturation of effector RNAs in a CRISPR interference pathway. Nat. Struct. Mol. Biol. 18:688‐692.
  Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M., Wildonger, J., and O'Connor‐Giles, K.M. 2013. Genome engineering of Drosophila with the CRISPR RNA‐guided Cas9 nuclease. Genetics 194:1029‐1035.
  Hale, C., Kleppe, K., Terns, R.M., and Terns, M.P. 2008. Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus. RNA 14:2572‐2579.
  Haurwitz, R.E., Jinek, M., Wiedenheft, B., Zhou, K., and Doudna, J.A. 2010. Sequence‐ and structure‐specific RNA processing by a CRISPR endonuclease. Science 329:1355‐1358.
  Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Jaenisch, R. 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29:731‐734.
  Horvath, P. and Barrangou, R. 2010. CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167‐170.
  Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.R., and Joung, J.K. 2013. Efficient genome editing in zebrafish using a CRISPR‐Cas system. Nat. Biotechnol. 31:227‐229.
  Ishino, Y., Shinagawa, H., Makino, K., Amemura, M., and Nakata, A. 1987. Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J. Bacteriol. 169:5429‐5433.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821.
  Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. 2013. RNA‐programmed genome editing in human cells. eLife 2:e00471.
  Jore, M.M., Lundgren, M., van Duijn, E., Bultema, J.B., Westra, E.R., Waghmare, S.P., Wiedenheft, B., Pul, U., Wurm, R., Wagner, R., Beijer, M.R., Barendregt, A., Zhou, K., Snijders, A.P., Dickman, M.J., Doudna, J.A., Boekema, E.J., Heck, A.J., van der Oost, J., and Brouns, S.J. 2011. Structural basis for CRISPR RNA‐guided DNA recognition by Cascade. Nat. Struct. Mol. Biol. 18:529‐536.
  Lintner, N., Kerou, M., Brumfield, S., Graham, S., Liu, H., Naismith, J.H., Sdano, M., Peng, N., She, Q., Copié, V., Young, M.J., White, M.F., and Lawrence, C.M. 2011. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)‐associated complex for antiviral defense (CASCADE). J. Biol. Chem. 286:21643‐21656.
  Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., Plath, K., and Hochedlinger, K. 2007. Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1:55‐70.
  Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013a. RNA‐guided human genome engineering via Cas9. Science 339:823‐826.
  Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., and Church, G.M. 2013b. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31:833‐838.
  Michalska, A.E. 2007. Isolation and propagation of mouse embryonic fibroblasts and preparation of mouse embryonic feeder layer cells. Curr. Protoc. Stem Cell Biol. 3:1C.3.1‐1C.3.17.
  Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.‐L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., Gregory, P.D., Pabo, C.O., and Rebar, E.J. 2007. An improved zinc‐finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25:778‐785.
  Park, I.‐H., Zhao, R., West, J.A, Yabuuchi, A., Huo, H., Ince, T.A, Lerou, P.H., Lensch, M.W., and Daley, G.Q. 2008. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451:141‐146.
  Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. 2013. Double nicking by RNA‐guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380‐1389.
  Saleh‐Gohari, N. and Helleday, T. 2004. Conservative homologous recombination preferentially repairs DNA double‐strand breaks in the S phase of the cell cycle in human cells. Nucleic Acids Res. 32:3683‐3688.
  Sashital, D.G., Jinek, M., and Doudna, J.A. 2011. An RNA‐induced conformational change required for CRISPR RNA cleavage by the endoribonuclease Cse3. Nat. Struct. Mol. Biol. 18:680‐687.
  Takahashi, K. and Yamanaka, S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663‐676.
  Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861‐872.
  Terns, M.P. and Terns, R.M. 2011. CRISPR‐based adaptive immune systems. Curr. Opin. Microbiol. 14:321‐327.
  Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. 2010. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genetics 11:636‐646.
  Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and Jaenisch, R. 2013. One‐step generation of mice carrying mutations in multiple genes by CRISPR/Cas‐mediated genome engineering. Cell 153:910‐918.
  Wang, R., Preamplume, G., Terns, M.P., Terns, R.M., and Li, H. 2011. Interaction of the Cas6 riboendonuclease with CRISPR RNAs: Recognition and cleavage. Structure 19:257‐264.
  Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E., and Jaenisch, R. 2007. In vitro reprogramming of fibroblasts into a pluripotent ES‐cell‐like state. Nature 448:318‐324.
  Wiedenheft, B., van Duijn, E., Bultema, J.B., Waghmare, S., Zhou, K., Barendregt, A., Westphal, W., Heck, A.J., Boekema, E.J., Dickman, M.J., and Doudna, J.A. 2011a. RNA‐guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. Proc. Natl. Acad. Sci. U.S.A. 108:10092‐10097.
  Wiedenheft, B., Lander, G.C., Zhou, K., Jore, M.M., Brouns, S.J., van der Oost, J., Doudna, J.A., and Nogales, E. 2011b. Structures of the RNA‐guided surveillance complex from a bacterial immune system. Nature 477:486‐489.
  Wiedenheft, B., Sternberg, S.H., and Doudna, J.A. 2012. RNA‐guided genetic silencing systems in bacteria and archaea. Nature 482:331‐338.
  Yu, J., Vodyanik, M.A, Smuga‐Otto, K., Antosiewicz‐Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Slukvin, I.I., and Thomson, J.A. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917‐1920.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library