CRISPR‐Cas9 Genome Editing in Drosophila

Scott J. Gratz1, C. Dustin Rubinstein2, Melissa M. Harrison3, Jill Wildonger4, Kate M. O'Connor‐Giles5

1 Genetics Training Program, University of Wisconsin‐Madison, Madison, Wisconsin, 2 Laboratory of Cell and Molecular Biology, University of Wisconsin‐Madison, Madison, Wisconsin, 3 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin, 4 Department of Biochemistry, University of Wisconsin‐Madison, Madison, Wisconsin, 5 Corresponding author: Kate M. O'Connor‐Giles (oconnorgiles@wisc.edu)
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.2
DOI:  10.1002/0471142727.mb3102s111
Online Posting Date:  July, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The CRISPR‐Cas9 system has transformed genome engineering of model organisms from possible to practical. CRISPR‐Cas9 can be readily programmed to generate sequence‐specific double‐strand breaks that disrupt targeted loci when repaired by error‐prone non‐homologous end joining (NHEJ) or to catalyze precise genome modification through homology‐directed repair (HDR). Here we describe a streamlined approach for rapid and highly efficient engineering of the Drosophila genome via CRISPR‐Cas9‐mediated HDR. In this approach, transgenic flies expressing Cas9 are injected with plasmids to express guide RNAs (gRNAs) and positively marked donor templates. We detail target‐site selection; gRNA plasmid generation; donor template design and construction; and the generation, identification, and molecular confirmation of engineered lines. We also present alternative approaches and highlight key considerations for experimental design. The approach outlined here can be used to rapidly and reliably generate a variety of engineered modifications, including genomic deletions and replacements, precise sequence edits, and incorporation of protein tags. © 2015 by John Wiley & Sons, Inc.

Keywords: CRISPR; Cas9; homology directed repair; genome engineering; Drosophila

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Genome engineering of Drosophila via homology‐directed repair using the CRISPR‐Cas9 system
  • Alternate Protocol 1: HDR with Single‐Stranded DNA Donors
  • Alternate Protocol 2: HDR in Any Genetic Background
  • Alternate Protocol 3: Generation Of Disruptive Indels and Deletions VIA NHEJ
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Genome engineering of Drosophila via homology‐directed repair using the CRISPR‐Cas9 system

  Materials
  • vasa‐Cas9 fly stocks (Bloomington Drosophila Stock Center)
    • y1 M{vas‐Cas9.RFP‐}ZH‐2A w1118/FM7a, P{Tb1}FM7‐A (stock number 55821)
    • w1118; PBac{vas‐Cas9}VK00037/CyO, P{Tb1}CprCyO‐A (stock number 56552)
    • w1118; PBac{vas‐Cas9}VK00027 (stock number 51324)
  • Total DNA purification kit (DNeasy Blood and Tissue Kit; Qiagen)
  • PCR and sequencing primers (see unit 15.1; Kramer and Coen, )
  • Phusion High‐Fidelity DNA Polymerase (New England Biolabs)
  • Gel extraction kit (Wizard SV Gel and PCR Clean‐Up Sytem; Promega)
  • Pair of short complementary oligonucleotides for cloning each target site (see information under step 12)
  • Nuclease free H 2O
  • 10 U/μl T4 polynucleotide kinase (New England Biolabs)
  • 10× T4 DNA ligase buffer (New England Biolabs)
  • pU6‐BbsI‐gRNA (Addgene; plasmid 45946)
  • BbsI restriction endonuclease
  • 400 U/μl T4 DNA ligase (New England Biolabs)
  • E. coli DH5α or other suitable cloning strain
  • LB agar plates containing 100 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • Plasmid miniprep kit (PureYield Plasmid Miniprep System; Promega)
  • Sequencing primers (also see unit 7.4; Slatko et al., ):
    • T7 (5′‐TAATACGACTCACTATAGGG‐3′)
    • T3 (5′‐ AATTAACCCTCACTAAAGGG‐3′)
  • Endotoxin‐Free Plasmid Midi Kit (Macherey‐Nagel NucleoBond Xtra Midi EF or similar)
  • Primers to amplify both homology arms (see information under step 23)
  • pHD primers:
    • pHD‐BB‐1 (5′‐ACGAAAGGCTCAGTCGAAAG‐3′)
    • pHD‐BB‐2 (5′‐TGATATCAAAATTATACATGTCAACG‐3′)
    • pHD‐HSP70‐R (5′‐CGGTCGAGGGTTCGAAATCGATAAG‐3′)
    • pHD‐SV40‐F (5′‐GGCCGCGACTCTAGATCATAATC‐3′)
  • 10 mM dNTP mix: 10 mM each of dATP, dCTP, dGTP, and dTTP
  • 5× HF Phusion Buffer (New England Biolabs)
  • pHD‐DsRed‐attP (Addgene; Plasmid 51019, also called pDSRed‐attP)
  • pHD‐DsRed (Addgene; Plasmid 51434)
  • AarI restriction endonuclease
  • LB liquid medium containing 100 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • Adult fly homogenization buffer (see Reagents and Solutions for recipe)
  • Proteinase K (New England Biolabs)
  • PCR and sequencing primers for identification and confirmation of CRISPR alleles (also see text under step 41):
    • pHD‐HSP70‐R (5′‐CGGTCGAGGGTTCGAAATCGATAAG‐3′)
    • pHD‐SV40‐F (5′‐GGCCGCGACTCTAGATCATAATC‐3′)
    • Left‐Genomic‐F (target locus specific)
    • Right‐Genomic‐R (target locus specific)
  • Thermal cycler
  • 0.2‐ml PCR tubes
  • Additional reagents and equipment for the polymerase chain reaction (PCR; unit 15.1; Kramer and Coen, ), agarose gel electrophoresis (unit 2.5; Voytas, ), Sanger sequencing (unit 7.4; Slatko et al., ), determination of nucleic acid concentration by spectrophotometry ( appendix 3D; Gallagher, ), transformation of E. coli (unit 1.8; Seidman et al., ), and microinjection of Drosophila embryos (Dobson, )

Alternate Protocol 1: HDR with Single‐Stranded DNA Donors

  Additional Materials (also see protocol 1Basic Protocol)
  • ssDNA donor with homology arms (see text under step 1)

Alternate Protocol 2: HDR in Any Genetic Background

  Additional Materials (also see protocol 1Basic Protocol)
  • pBS‐Hsp70‐Cas9 plasmid (Addgene; plasmid 46294)

Alternate Protocol 3: Generation Of Disruptive Indels and Deletions VIA NHEJ

  Additional Materials (also see protocol 1Basic Protocol)
  • gRNAs for introducing a disruptive indel (see text under step 1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Anton, T., Bultmann, S., Leonhardt, H., and Markaki, Y. 2014. Visualization of specific DNA sequences in living mouse embryonic stem cells with a programmable fluorescent CRISPR/Cas system. Nucleus 5:163‐172.
  Banga, S.S. and Boyd, J.B. 1992. Oligonucleotide‐directed site‐specific mutagenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 89:1735‐1739.
  Bassett, A.R. and Liu, J.L. 2014. CRISPR/Cas9 and genome editing in Drosophila. J. Genet. Genomics 41:7‐19.
  Bassett, A.R., Tibbit, C., Ponting, C.P., and Liu, J.L. 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4:220‐228.
  Beumer, K.J., Trautman, J.K., Mukherjee, K., and Carroll, D. 2013. Donor DNA utilization during gene targeting with zinc‐finger nucleases. G3 (Bethesda) doi: 10.1534/g3.112.005439 [Epub ahead of print].
  Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., and Marraffini, L.A. 2013. Programmable repression and activation of bacterial gene expression using an engineered CRISPR‐Cas system. Nucleic Acids Res. 41:7429‐7437.
  Chen, B., Gilbert, L.A., Cimini, B.A., Schnitzbauer, J., Zhang, W., Li, G.W., Park, J., Blackburn, E.H., Weissman, J.S., Qi, L.S., and Huang, B. 2013. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155:1479‐1491.
  Cheng, A.W., Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T.W., Rangarajan, S., Shivalila, C.S., Dadon, D.B., and Jaenisch, R. 2013. Multiplexed activation of endogenous genes by CRISPR‐on, an RNA‐guided transcriptional activator system. Cell Res. 23:1163‐1171.
  Chiu, H., Schwartz, H.T., Antoshechkin, I., and Sternberg, P.W. 2013. Transgene‐free genome editing in Caenorhabditis elegans using CRISPR‐Cas. Genetics 195:1167‐1171.
  Deng, C. and Capecchi, M.R. 1992. Reexamination of gene targeting frequency as a function of the extent of homology between the targeting vector and the target locus. Mol. Cell. Biol. 12:3365‐3371.
  Dobson, S.L. 2007. Transfection of Wolbachia pipientis into Drosophila embryos. Curr. Protoc. Microbiol. 5:A.4.1‐3A.4.11.
  Duan, J., Lu, G., Xie, Z., Lou, M., Luo, J., Guo, L., and Zhang, Y. 2014. Genome‐wide identification of CRISPR/Cas9 off‐targets in human genome. Cell Res. 24:1009‐1012.
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1‐1.1.7.
  Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M., and Joung, J.K. 2014. Improving CRISPR‐Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32:279‐284.
  Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D. 2013. High‐frequency off‐target mutagenesis induced by CRISPR‐Cas nucleases in human cells. Nat. Biotechnol. 31:822‐826.
  Fujita, T. and Fujii, H. 2013. Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA‐binding molecule‐mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem. Biophys. Res. Commun. 439:132‐136.
  Gallagher, S.R. 2011. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 93:A.3D.1‐A.3D.14.
  Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern‐Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., Lim, W.A., Weissman, J.S., and Qi, L.S. 2013. CRISPR‐mediated modular RNA‐guided regulation of transcription in eukaryotes. Cell 154:442‐451.
  Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M., Wildonger, J., and O'Connor‐Giles, K.M. 2013a. Genome engineering of Drosophila with the CRISPR RNA‐guided Cas9 nuclease. Genetics 194:1029‐1035.
  Gratz, S.J., Wildonger, J., Harrison, M.M., and O'Connor‐Giles, K.M. 2013b. CRISPR/Cas9‐mediated genome engineering and the promise of designer flies on demand. Fly 7:249‐255.
  Gratz, S.J., Ukken, F.P., Rubinstein, C.D., Thiede, G., Donohue, L.K., Cummings, A.M., and O'Connor‐Giles, K.M. 2014. Highly specific and efficient CRISPR/Cas9‐catalyzed homology‐directed repair in Drosophila. Genetics 196:961‐971.
  Harrison, M.M., Jenkins, B.V., O'Connor‐Giles, K.M., and Wildonger, J. 2014. A CRISPR view of development. Genes Dev. 28:1859‐1872.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821.
  Kearns, N.A., Genga, R.M., Enuameh, M.S., Garber, M., Wolfe, S.A., and Maehr, R. 2014. Cas9 effector‐mediated regulation of transcription and differentiation in human pluripotent stem cells. Development 141:219‐223.
  Kiskinis, E., Sandoe, J., Williams, L.A., Boulting, G.L., Moccia, R., Wainger, B.J., Han, S., Peng, T., Thams, S., Mikkilineni, S., Mellin, C., Merkle, F.T., Davis‐Dusenbery, B.N., Ziller, M., Oakley, D., Ichida, J., Di Costanzo, S., Atwater, N., Maeder, M.L., Goodwin, M.J., Nemesh, J., Handsaker, R.E., Paull, D., Noggle, S., McCarroll, S.A., Joung, J.K., Woolf, C.J., Brown, R.H., and Eggan, K. 2014. Pathways disrupted in human ALS motor neurons identified through genetic correction of mutant SOD1. Cell Stem Cell 14:781‐795.
  Koike‐Yusa, H., Li, Y., Tan, E.P., Velasco‐Herrera Mdel, C., and Yusa, K. 2014. Genome‐wide recessive genetic screening in mammalian cells with a lentiviral CRISPR‐guide RNA library. Nat. Biotechnol. 32:267‐273.
  Kondo, S. 2014. New horizons in genome engineering of Drosophila melanogaster. Genes Genet. Syst. 89:3‐8.
  Kondo, S. and Ueda, R. 2013. Highly improved gene targeting by germline‐specific Cas9 expression in Drosophila. Genetics 195:715‐721.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Lee, J.S., Kwak, S.J., Kim, J., Kim, A.K., Noh, H.M., Kim, J.S., and Yu, K. 2014. RNA‐guided genome editing in Drosophila with the purified Cas9 protein. G3 (Bethesda) 4:1291‐1295.
  Maeder, M.L., Linder, S.J., Cascio, V.M., Fu, Y., Ho, Q.H., and Joung, J.K. 2013. CRISPR RNA‐guided activation of endogenous human genes. Nat. Methods 10:977‐979.
  Miklos, A.E., Hughes, R.A., and Ellington, A.D. 2012. Design and assembly of large synthetic DNA constructs. Curr. Protoc. Mol. Biol. 99:3.23.1‐3.23.18.
  Nassif, N. and Engels, W. 1993. DNA homology requirements for mitotic gap repair in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 90:1262‐1266.
  Perez‐Pinera, P., Kocak, D.D., Vockley, C.M., Adler, A.F., Kabadi, A.M., Polstein, L.R., Thakore, P.I., Glass, K.A., Ousterout, D.G., Leong, K.W., Guilak, F., Crawford, G.E., Reddy, T.E., and Gersbach, C.A. 2013. RNA‐guided gene activation by CRISPR‐Cas9‐based transcription factors. Nat. Methods 10:973‐976.
  Port, F., Chen, H.M., Lee, T., and Bullock, S.L. 2014. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 111:E2967‐E2976.
  Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., and Lim, W.A. 2013. Repurposing CRISPR as an RNA‐guided platform for sequence‐specific control of gene expression. Cell 152:1173‐1183.
  Ren, X., Sun, J., Housden, B.E., Hu, Y., Roesel, C., Lin, S., Liu, L.P., Yang, Z., Mao, D., Sun, L., Wu, Q., Ji, J.Y., Xi, J., Mohr, S.E., Xu, J., Perrimon, N., and Ni, J.Q. 2013. Optimized gene editing technology for Drosophila melanogaster using germ line‐specific Cas9. Proc. Natl. Acad. Sci. U.S.A. 110:19012‐19017.
  Sebo, Z.L., Lee, H.B., Peng, Y., and Guo, Y. 2014. A simplified and efficient germline‐specific CRISPR/Cas9 system for Drosophila genomic engineering. Fly 8:52‐57.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Slatko, B.E., Albright, L.M., Tabor, S., and Ju, J. 1999. DNA sequencing by the dideoxy method. Curr. Protoc. Mol. Biol. 47:7.4A.1‐7.4A.39.
  Smith, C., Gore, A., Yan, W., Abalde‐Atristain, L., Li, Z., He, C., Wang, Y., Brodsky, R.A., Zhang, K., Cheng, L., and Ye, Z. 2014. Whole‐genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN‐based genome editing in human iPSCs. Cell Stem Cell 15:12‐13.
  Suzuki, K., Yu, C., Qu, J., Li, M., Yao, X., Yuan, T., Goebl, A., Tang, S., Ren, R., Aizawa, E., Zhang, F., Xu, X., Soligalla, R.D., Chen, F., Kim, J., Kim, N.Y., Liao, H.K., Benner, C., Esteban, C.R., Jin, Y., Liu, G.H., Li, Y., and Izpisua Belmonte, J.C. 2014. Targeted gene correction minimally impacts whole‐genome mutational load in human‐disease‐specific induced pluripotent stem cell clones. Cell Stem Cell 15:31‐36.
  Veres, A., Gosis, B.S., Ding, Q., Collins, R., Ragavendran, A., Brand, H., Erdin, S., Talkowski, M.E., and Musunuru, K. 2014. Low incidence of off‐target mutations in individual CRISPR‐Cas9 and TALEN targeted human stem cell clones detected by whole‐genome sequencing. Cell Stem Cell 15:27‐30.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Xue, Z., Ren, M., Wu, M., Dai, J., Rong, Y.S., and Gao, G. 2014. Efficient gene knock‐out and knock‐in with transgenic Cas9 in Drosophila. G3 (Bethesda) 4:925‐929.
  Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., and Jaenisch, R. 2013. One‐step generation of mice carrying reporter and conditional alleles by CRISPR/Cas‐mediated genome engineering. Cell 154:1370‐1379.
  Yu, Z., Ren, M., Wang, Z., Zhang, B., Rong, Y.S., Jiao, R., and Gao, G. 2013. Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195:289‐291.
  Yu, Z., Chen, H., Liu, J., Zhang, H., Yan, Y., Zhu, N., Guo, Y., Yang, B., Chang, Y., Dai, F., Liang, X., Chen, Y., Shen, Y., Deng, W.M., Chen, J., Zhang, B., Li, C., and Jiao, R. 2014. Various applications of TALEN‐ and CRISPR/Cas9‐mediated homologous recombination to modify the Drosophila genome. Biol. Open 3:271‐280.
Internet Resources
Reagents
  http://flystocks.bio.indiana.edu/Browse/misc‐browse/CRISPR.htm
  Bloomington Drosophila Stock Center CRISPR stocks.
  http://www.addgene.org/CRISPR/drosophila/
  Addgene CRISPR plasmids.
Target finder tools
  http://tools.flycrispr.molbio.wisc.edu/targetFinder/
  CRISPR Optimal Target Finder.
  http://www.flyrnai.org/crispr2/
  DRSC Find CRISPRs.
  http://crispr.mit.edu
  CRISPR Design.
  http://www.e‐crisp.org/E‐CRISP/
  E‐CRISP.
Discussion groups
  https://groups.google.com/forum/#!forum/flycrispr‐discussion‐group
  flyCRISPR discussion group.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library