Genome Editing in Human Cells Using CRISPR/Cas Nucleases

Nicolas Wyvekens1, Shengdar Q. Tsai2, J. Keith Joung2

1 Molecular Pathology Unit, Center for Computational and Integrative Biology and Center for Cancer Research, Massachusetts General Hospital, Charlestown, Massachusetts, 2 Department of Pathology, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.3
DOI:  10.1002/0471142727.mb3103s112
Online Posting Date:  October, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR‐associated (Cas) system has been broadly adopted for highly efficient genome editing in a variety of model organisms and human cell types. Unlike previous genome editing technologies such as zinc finger nucleases (ZFNs) and transcription activator−like effector nucleases (TALENs), CRISPR/Cas technology does not require complex protein engineering and can be utilized by any researcher proficient in basic molecular biology and cell culture techniques. This unit describes protocols for design and cloning of vectors expressing single or multiplex gRNAs, for transient transfection of human cell lines, and for quantitation of mutation frequencies by T7 endonuclease I assay. These protocols also include guidance for using two improvements that increase the specificity of CRISPR/Cas nucleases: truncated gRNAs and dimeric RNA‐guided FokI nucleases. © 2015 by John Wiley & Sons, Inc.

Keywords: CRISPR; Cas9; genome editing; human cells; tru‐gRNA; RNA‐guided FokI nucleases; FokI‐dCas9

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Target Site Identification and Single Expression Vector Cloning for Conventional CRISPR/Cas9 and tru‐gRNA Technologies
  • Alternate Protocol 1: Target Site Identification and Multiplex gRNA Vector Cloning for RFNs
  • Basic Protocol 2: Transient Transfection of Human HEK‐293 Cells
  • Alternate Protocol 2: Transient Transfection of Human U2OS Cells
  • Basic Protocol 3: Quantification of Genomic DNA Mutation Frequencies by T7 Endonuclease I Assay
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Target Site Identification and Single Expression Vector Cloning for Conventional CRISPR/Cas9 and tru‐gRNA Technologies

  Materials
  • DNA sequence of genomic target region
  • Bacteria bearing pMLM3636 (Addgene plasmid 43860)
  • Bacteria bearing pSQT817 (Addgene plasmid 53373)
  • LB liquid medium and agar plates (unit 1.1; Elbing and Brent, ) with 100 μg/ml carbenicillin
  • QIAprep Spin Miniprep Kit (Qiagen) with 0.1× Elution Buffer
  • 10 U/μl BsmBI restriction enzyme with 10× NEBuffer 3.1 (New England Biolabs)
  • QIAquick Gel Extraction Kit (Qiagen)
  • 10× TE buffer (see recipe)
  • Nuclease‐free water
  • 10× STE buffer (see recipe)
  • 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs)
  • 10 U/μl T4 polynucleotide kinase (New England Biolabs)
  • Chemically competent XL1‐Blue cells (Stratagene)
  • SOC medium (unit 1.8; Seidman et al., 1998)
  • Sequencing primer OS280: 5′‐CAGGGTTATTGTCTCATGAGCGG‐3′
  • HiSpeed Plasmid Midi Kit (Qiagen)
  • Computer with internet access
  • 37°C incubator
  • Heating block(s) at 16°, 42°, 55°, and 80°C
  • Thermocycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, ) and DNA sequencing

Alternate Protocol 1: Target Site Identification and Multiplex gRNA Vector Cloning for RFNs

  Additional Materials (also see protocol 1)
  • Bacteria bearing pSQT1313 (Addgene plasmid 53370)
  • Bacteria bearing pSQT1601 (Addgene plasmid 53369)
  • oSQT875 middle RFN oligo 1 (20 nmol Ultramer DNA, IDT): 5′‐phos‐AGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCACTGCCGTATA
  • oSQT876 middle RFN oligo 2 (20 nmol Ultramer DNA, IDT): 5′‐phos‐TGCCTATACGGCAGTGAACGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT

Basic Protocol 2: Transient Transfection of Human HEK‐293 Cells

  Materials
  • Human embryonic kidney (HEK‐293) cells
  • Phosphate‐buffered saline (PBS, Life Technologies)
  • Cell culture medium (see recipe)
  • Midiprep of nuclease expression vector (pSQT817 or pSQT1601; see protocol 1 or protocol 2)
  • Midiprep of single or multiplex gRNA expression vector (see protocol 1 or protocol 2)
  • Midiprep of ptdTomato‐N1 plasmid (Clontech)
  • TransIT‐LT1 Transfection Reagent (Mirus)
  • Opti‐MEM reduced serum medium (Life Technologies)
  • 24‐well tissue culture plate
  • Fluorescence microscope
  • Additional reagents and equipment for trypsinization ( appendix 3F; Phelan, )

Alternate Protocol 2: Transient Transfection of Human U2OS Cells

  Additional Materials (also see protocol 3)
  • Human osteosarcoma (U2OS) cells
  • Falcon nylon cell strainer (100‐μm mesh, Fisher Scientific)
  • Falcon tube
  • SE Cell Line 4D‐Nucleofector X Kit S (Lonza)
  • 4D‐Nucleofector System (Lonza)

Basic Protocol 3: Quantification of Genomic DNA Mutation Frequencies by T7 Endonuclease I Assay

  Materials
  • Transfected cells (see protocol 3 or protocol 4)
  • Genomic DNA isolation kit (e.g., Agencourt DNAdvance, Beckmann Coulter)
  • 2 U/μl Phusion Hot‐start FLEX DNA polymerase and 5× Phusion polymerase HF buffer (New England Biolabs)
  • 10 mM dNTPs
  • DNA primer pair for each target locus
  • Nuclease‐free water
  • PCR purification kit (e.g., Agencourt AMPure XP, Beckmann Coulter)
  • 10× NEBuffer 2 (New England Biolabs)
  • 10 U/μl T7 Endonuclease I (T7EI; New England Biolabs)
  • 0.25 M EDTA ( appendix 22)
  • Magnetic bead separator
  • Thermocycler
  • QIAxcel Advanced Instrument with QIAxcel DNA High Resolution kit (Qiagen)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1‐1.1.7.
  Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D. 2013. High‐frequency off‐target mutagenesis induced by CRISPR‐Cas nucleases in human cells. Nat. Biotechnol. 31:822‐826. doi: 10.1038/nbt.2623.
  Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M., and Joung, J.K. 2014. Improving CRISPR‐Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32:279‐284. doi: 10.1038/nbt.2808.
  Guilinger, J.P., Thompson, D.B., and Liu, D.R. 2014. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 32:577‐582. doi: 10.1038/nbt.2909.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821.
  Maddalo, D., Manchado, E., Concepcion, C.P., Bonetti, C., Vidigal, J.A., Han, Y.‐C., Ogrodowski, P., Crippa, A., Rekhtman, N., de Stanchina, E., Lowe, S.W., and Ventura, A. 2014. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature 516:423‐427.
  Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., and Church, G.M. 2013. Cas9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31:833‐838.
  Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., and Liu, D.R. 2013. High‐throughput profiling of off‐target DNA cleavage reveals RNA‐programmed Cas9 nuclease specificity. Nat. Biotechnol. 31:839‐843.
  Phelan, M.C. 2006. Techniques for mammalian cell tissue culture. Curr. Protoc. Mol. Biol. 74:A.3F.1‐A.3F.18.
  Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D., and Joung, J.K. 2012. FLASH assembly of TALENs for high‐throughput genome editing. Nat. Biotechnol. 30:460‐465.
  Sander, J.D. and Joung, J.K. 2014. CRISPR‐Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32:347‐355.
  Sander, J.D., Maeder, M.L., Reyon, D., Voytas, D.F., Joung, J.K., and Dobbs, D. 2010. ZiFiT (Zinc Finger Targeter): An updated zinc finger engineering tool. Nucleic Acids Res. 38:W462‐W468.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Tsai, S.Q., Wyvekens, N., Khayter, C., Foden, J.A., Thapar, V., Reyon, D., Goodwin, M.J., Aryee, M.J., and Joung, J.K. 2014. Dimeric CRISPR RNA‐guided FokI nucleases for highly specific genome editing. Nat. Biotechnol. 32:569‐576.
  Tsai, S.Q., Zheng, Z., Nguyen, N.T., Liebers, M., Topkar, V.V., Thapar, V., Wyvekens, N., Khayter, C., Iafrate, A.J., Le, L.P., Aryee, M.J., and Joung, J.K. 2015. GUIDE‐seq enables genome‐wide profiling of off‐target cleavage by CRISPR‐Cas nucleases. Nat. Biotechnol. 33:187‐197.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wyvekens, N., Topkar, V.V., Khayter, C., Joung, J.K., and Tsai, S.Q. 2015. Dimeric CRISPR RNA‐guided FokI‐dCas9 nucleases directed by truncated gRNAs for highly specific genome editing. Hum. Gene Ther. 26:425‐431.
Key References
  Sander and Joung, 2014. See above.
  Comprehensive review of CRISPR/Cas9 technology.
  Fu et al., 2014. See above.
  Compares the genome editing efficiency and specificity of tru‐gRNA and conventional CRISPR/Cas technology in human cells.
  Tsai et al., 2014. See above.
  Describes the dimeric RFN platform in human cells and compares its genome editing efficiency and specificity with the conventional CRISPR/Cas system.
Internet Resources
  http://zifit.partners.org/ZiFiT/
  Provides assistance in finding target sites for conventional CRISPR/Cas nucleases as well as tru‐gRNA and RFN technologies. Also identifies DNA oligo sequences compatible with these single and multiplex gRNA expression vector cloning protocols.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library