CRISPR/Cas9‐Based Multiplex Genome Editing in Monocot and Dicot Plants

Xingliang Ma1, Yao‐Guang Liu1

1 College of Life Sciences, South China Agricultural University, Guangzhou
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.6
DOI:  10.1002/cpmb.10
Online Posting Date:  July, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9‐mediated genome targeting system has been applied to a variety of organisms, including plants. Compared to other genome‐targeting technologies such as zinc‐finger nucleases (ZFNs) and transcription activator–like effector nucleases (TALENs), the CRISPR/Cas9 system is easier to use and has much higher editing efficiency. In addition, multiple “single guide RNAs” (sgRNAs) with different target sequences can be designed to direct the Cas9 protein to multiple genomic sites for simultaneous multiplex editing. Here, we present a procedure for highly efficient multiplex genome targeting in monocot and dicot plants using a versatile and robust CRISPR/Cas9 vector system, emphasizing the construction of binary constructs with multiple sgRNA expression cassettes in one round of cloning using Golden Gate ligation. We also describe the genotyping of targeted mutations in transgenic plants by direct Sanger sequencing followed by decoding of superimposed sequencing chromatograms containing biallelic or heterozygous mutations using the Web‐based tool DSDecode. © 2016 by John Wiley & Sons, Inc.

Keywords: CRISPR/Cas9; multiplex genome editing; mutant genotyping; plants

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of the Starting Materials for Construct Preparation
  • Basic Protocol 2: Assembly of sgRNA Expression Cassettes into a CRISPR/Cas9 Binary Construct
  • Basic Protocol 3: Transformation of E. coli and A. tumefaciens Strains
  • Basic Protocol 4: Sequencing Analysis of Targeted Mutations in Transgenic Plants
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of the Starting Materials for Construct Preparation

  Materials
  • E. coli TOP10F′ strain(s) carrying the pYLCRISPR/Cas9 plasmid(s) (Fig.  A) used for preparation of construct(s) with sgRNA expression cassette(s) for plant transformation (Addgene, plasmid nos. 66187, 66188, 6189, 66190, 66191; https://www.addgene.org/)
  • E. coli DH10B strain(s) carrying the pYLsgRNA intermediate plasmid(s) with appropriate U3/U6 promoters for monocot and/or dicot plant(s) (Fig.  B,C) (Addgene, plasmid nos. 66192, 66193, 66194, 66195, 66196, 66197, 66198, 66199, 66200, 66201, 66202, 66203)
  • LB agar plates containing 25 μg/ml kanamycin (unit 1.1; Elbing and Brent, )
  • LB agar plate containing 100 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • LB liquid medium containing 25 μg/ml kanamycin (unit 1.1; Elbing and Brent, )
  • LB liquid medium containing 50 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • Plasmid miniprep kit
  • TE buffer, pH 8.0 ( appendix 22)
  • EndoFree Maxi Plasmid Kit (Tiangen, cat. no. DP117)
  • Universal primer set for amplifying the sgRNA constructs (primers UF and gR‐R; Table 31.6.1)
  • Shaking incubator or tube roller
  • Nanodrop microspectrophotometer ( appendix 3J)
Table 1.6.1   MaterialsPrimers Used for Preparation of sgRNA Expression Cassettes for Golden Gate Cloning

Position Primer set Sequence (5′‐3′)
1st PCR UF CTCCGTTTTACCTGTGGAATCG
gR‐R CGGAGGAAAATTCCATCCAC
2nd PCR
Site B‐R Pps‐R TTCAGAggtctcTACCGACTAGTATGGAATCGGCAGCAAAGG
Site 2 Pgs‐2 AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC
Site 2 Pps‐2 TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG
Site 3 Pgs‐3 AGCGTGggtctcGtcttcacTCCATCCACTCCAAGCTC
Site 3 Pps‐3 TTCAGAggtctcTaagacttTGGAATCGGCAGCAAAGG
Site 4 Pgs‐4 AGCGTGggtctcGagtccttTCCATCCACTCCAAGCTC
Site 4 Pps‐4 TTCAGAggtctcTgactacaTGGAATCGGCAGCAAAGG
Site 5 Pgs‐5 AGCGTGggtctcGgtccacaTCCATCCACTCCAAGCTC
Site 5 Pps‐5 TTCAGAggtctcTggacttgTGGAATCGGCAGCAAAGG
Site 6 Pgs‐6 AGCGTGggtctcGcagatagTCCATCCACTCCAAGCTC
Site 6 Pps‐6 TTCAGAggtctcTtctgcaaTGGAATCGGCAGCAAAGG
Site 7 Pgs‐7 AGCGTGggtctcGacctcaaTCCATCCACTCCAAGCTC
Site 7 Pps‐7 TTCAGAggtctcTaggtttcTGGAATCGGCAGCAAAGG
Site 8 Pgs‐8 AGCGTGggtctcGagcgttcTCCATCCACTCCAAGCTC
Site 8 Pps‐8 TTCAGAggtctcTcgctgatTGGAATCGGCAGCAAAGG
Site B‐L Pgs‐L AGCGTGggtctcGCTCGACGCGTATCCATCCACTCCAAGCTC
Flanking PB‐R GCGCGCgGTctcGACCGACTAGTATGG
primers PB‐L GCGCGCggtctcTCTCGACGCGTATCC

 aThe BsaI‐cut non‐palindromic ends are sequentially compatible for Golden Gate ligation.
 bACTAGT and ACGCGT are SpeI and MluI sites, respectively. The SpeI site is unique in the built constructs, which can be used for cloning of a second group of sgRNA expression cassettes, if necessary, using the Gibson Assembly method.
 cIf more than 8 sgRNA expression cassettes are assembled in a binary construct using one round of Golden Gate cloning, new position‐specific primers with distinct BsaI‐cleaving sites can be designed.

Basic Protocol 2: Assembly of sgRNA Expression Cassettes into a CRISPR/Cas9 Binary Construct

  Materials
  • Purified binary vectors and sgRNA intermediate plasmids (see protocol 1)
  • 10 × CutSmart buffer (New England Biolabs, cat. no. R3535s)
  • 20 U/μl BsaI‐HF
  • ATP (Thermo Scientific, cat. no. R0441)
  • T4 DNA ligase and 10 × buffer (New England Biolabs, cat. no. M0202s, 400 U/µl)
  • Primer sets (Table 31.6.1)
  • KOD Plus high‐fidelity DNA polymerase and 10× buffer containing 250 μM dNTPs (Toyobo, cat. no. KOD‐201)
  • PCR product purification kit
  • Agarose gel DNA purification kit
  • High‐fidelity DNA polymerase suitable for long‐range PCR: KOD FX and 2 × buffer with 250 μM dNTPs (Toyobo, cat. no. KFX‐101)
  • PCR thermal cycler
  • Nanodrop microspectrophotometer ( appendix 3J)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and ethanol precipitation method for DNA purification (unit 2.1; Moore and Dowhan, )

Basic Protocol 3: Transformation of E. coli and A. tumefaciens Strains

  Materials
  • Ligation product (from protocol 2, step 12, or step 17 if the PB‐R and PB‐L primers are used)
  • 0.3× TE buffer, pH 8.0 (see appendix 22 for 1× buffer)
  • E. coli DH10B competent cells
  • SOC medium (unit 1.8; Seidman et al., )
  • LB agar plates (unit 1.1; Elbing and Brent, ) containing 25 μg/ml kanamycin, 0.5 mM IPTG, and 40 μl of 20 mg/ml Xgal per 90‐mm‐diameter plate
  • Taq DNA polymerase
  • Plasmid miniprep kit
  • MluI (Takara, cat. no. 1071 A, or New England Biolabs, cat. no. R0198s)
  • AscI (New England Biolabs, cat. no. R0558s)
  • Target adapter primers to form primer sets (Figs. A and A)
  • A. tumefaciens competent cell strain, e.g., EHA105
  • YM agar medium (see recipe)
  • Millipore VSWP04700 dialysis filter (pore size: 0.025 μm)
  • Gene Pulser Xcell Electroporation System (BioRad, cat. no. 617BR1‐08950) with 1‐mm electroporation cuvettes
  • Shaking incubator
  • Additional reagents and equipment for ethanol precipitation method for DNA purification (unit 2.1; Moore and Dowhan, ), electroporation (unit 1.8; Seidman et al., ), the polymerase chain reaction (PCR; unit 15.1; Kramer and Coen, ), DNA sequencing (see Chapter 7 in this manual), and colony PCR (Woodman, )

Basic Protocol 4: Sequencing Analysis of Targeted Mutations in Transgenic Plants

  Materials
  • Taq DNA polymerase and10× buffer
  • Agarose gel DNA purification kit
  • Additional reagents and equipment for the polymerase chain reaction (PCR; unit 15.1; Kramer and Coen, ), DNA sequencing (see Chapter 7 in this manual), and agarose gel electrophoresis (Voytas, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Chen, F., Pruett‐Miller, S.M., Huang, Y., Gjoka, M., Duda, K., Taunton, J., Collingwood, T.N., Frodin, M., and Davis, G.D. 2011. High‐frequency genome editing using ssDNA oligonucleotides with zinc‐finger nucleases. Nat. Methods 8:753‐755. doi: 10.1038/nmeth.1653.
  Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823. doi: 10.1126/science.1231143.
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1‐1.1.7.
  Engler, C., Kandzia, R., and Marillonnet, S. 2008. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3:e3647. doi: 10.1371/journal.pone.0003647.
  Fan, D., Liu, T., Li, C., Jiao, B., Li, S., Hou, Y., and Luo, K. 2015. Efficient CRISPR/Cas9‐mediated targeted mutagenesis in populus in the first generation. Sci. Rep. 5:12217. doi: 10.1038/srep12217.
  Fauser, F., Schiml, S., and Puchta, H. 2014. Both CRISPR/Cas‐based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J. 79:348‐359. doi: 10.1111/tpj.12554.
  Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.R., and Smith, H.O. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6:343‐345. doi: 10.1038/nmeth.1318.
  Jiang, W., Zhou, H., Bi, H., Fromm, M., Yang, B., and Weeks, D.P. 2013. Demonstration of CRISPR/Cas9/sgRNA‐mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 41:e188. doi: 10.1093/nar/gkt780.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821. doi: 10.1126/science.1225829.
  Kramer, M.F. and Coen, D. M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Li, T., Huang, S., Zhao, X., Wright, D.A., Carpenter, S., and Spalding, M.H. 2011. Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic Acids Res. 39:6315‐6325. doi: 10.1093/nar/gkr188.
  Li, J.F., Norville, J.E., Aach, J., McCormack, M., Zhang, D., Bush, J., Church, G.M., and Sheen, J. 2013. Multiplex and homologous recombination‐mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol. 31:688‐691. doi: 10.1038/nbt.2654.
  Liu, W., Xie, X., Ma, X., Li, J., Chen, J., and Liu, Y.G. 2015. DSDecode: A web‐based tool for decoding of sequencing chromatograms for genotyping of targeted mutations. Mol. Plant 8:1431‐1433. doi: 10.1016/j.molp.2015.05.009.
  Ma, X. Chen, L., Zhu, Q., and Liu, Y. 2015b. Rapid decoding of sequence‐specific nuclease‐induced heterozygous and biallelic mutations by direct sequencing of PCR products. Mol. Plant 8:1285‐1287. doi: 10.1016/j.molp.2015.02.012.
  Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., Xie, Y., Shen, R., Chen, S., Wang, Z., Chen, Y., Guo, J., Chen, L., Zhao, X., Dong, Z., and Liu, Y.G. 2015a. A robust CRISPR/Cas9 system for convenient, high‐efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 8:1274‐1284. doi: 10.1016/j.molp.2015.04.007.
  Mao, Y., Zhang, H., Xu, N., Zhang, B., Gou, F., and Zhu, J.K. 2013. Application of the CRISPR‐Cas system for efficient genome engineering in plants. Mol. Plant 6:2008‐2011. doi: 10.1093/mp/sst121.
  Miao, J., Guo, D., Zhang, J., Huang, Q., Qin, G., Zhang, X., Wan, J., Gu, H., and Qu, L.J. 2013. Targeted mutagenesis in rice using CRISPR‐Cas system. Cell Res. 23:1233‐1236. doi: 10.1038/cr.2013.123.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
  Saleh‐Gohari, N. and Helleday, T. 2004. Conservative homologous recombination preferentially repairs DNA double‐strand breaks in the S phase of the cell cycle in human cells. Nucleic Acids Res. 32:3683‐3688. doi: 10.1093/nar/gkh703.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Shan, Q., Wang, Y., Li, J., Zhang, Y., Chen, K., Liang, Z., Zhang, K., Liu, J., Xi, J.J., Qiu, J.L., and Gao, C. 2013b. Targeted genome modification of crop plants using a CRISPR‐Cas system. Nat. Biotechnol. 31:686‐688. doi: 10.1038/nbt.2650.
  Shan, Q., Wang, Y., Chen, K., Liang, Z., Li, J., Zhang, Y., Zhang, K., Liu, J., Voytas, D.F., Zheng, X., Zhang, Y., Zhang, Y., and Gao, C. 2013a. Rapid and efficient gene modification in rice and Brachypodium using TALENs. Mol. Plant 6:1365‐1368. doi: 10.1093/mp/sss162.
  Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. 2010. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genetics 11:636‐646. doi: 10.1038/nrg2842.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and Jeanisch, R. 2013b. One‐step generation of mice carrying mutations in multiple genes by CRISPR/Cas‐mediated genome engineering. Cell 153:910‐918. doi: 10.1016/j.cell.2013.04.025.
  Wang, H., Hu, Y.C., Markoulaki, S., Welstead, G.G., Cheng, A.W., Shivalila, C.S., Pyntikova, T., Dadon, D.B., Voytas, D.F., Bogdanove, A.J., Page, D.C., and Jaenisch, R. 2013a. TALEN‐mediated editing of the mouse Y chromosome. Nat. Biotechnol. 31:530‐532. doi: 10.1038/nbt.2595.
  Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C. Leung, E., Meng, X., Zhang, L., Rebar, E.J. Gregory, P.D., Urnov, F.D., and Meyer, B.J. 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333:307. doi: 10.1126/science.1207773.
  Woodman, M. E. 2008. Direct PCR of intact bacteria (colony PCR). Curr. Protoc. Microbiol. 9:A.3D.1‐A.3D.6.
  Xie, K. and Yang, Y. 2013. RNA‐guided genome editing in plants using a CRISPR‐Cas system. Mol. Plant 6:1975‐1983. doi: 10.1093/mp/sst119.
  Xing, H.L., Dong, L., Wang, Z.P., Zhang, H.Y., Han, C.Y., Liu, B., Wang, X.C., and Chen, Q.J. 2014. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14:327. doi: 10.1186/s12870‐014‐0327‐y.
  Zhang, H., Zhang, J., Wei, P., Zhang, B., Gou, F., Feng, Z., Mao, Y., Yang, L., Zhang, H., Xu, N., and Zhu, J.K. 2014. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 12:797‐807. doi: 10.1111/pbi.12200.
  Zhou, H., Liu, B., Weeks, D.P., Spalding, M.H., and Yang, B. 2014. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Res. 42:10903‐10914. doi: 10.1093/nar/gku806.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library