CRISPR‐Cas9‐Guided Genome Engineering in C. elegans

Hyun‐Min Kim1, Monica P. Colaiácovo1

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.7
DOI:  10.1002/cpmb.7
Online Posting Date:  July, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The CRISPR (clustered regularly interspaced short palindromic repeats)–Cas (CRISPR‐associated) system is successfully being used for efficient and targeted genome editing in various organisms, including the nematode C. elegans. Recent studies have developed various CRISPR‐Cas9 approaches to enhance genome engineering via two major DNA double‐strand break repair pathways: non‐homologous end joining and homologous recombination. Here we describe a protocol for Cas9‐mediated C. elegans genome editing together with single guide RNA (sgRNA) and repair template cloning, as well as injection methods required for delivering Cas9, sgRNAs, and repair template DNA into the C. elegans germline. © 2016 by John Wiley & Sons, Inc.

Keywords: Cas9; C. elegans; CRISPR; CRISPR‐Cas; genome editing; genome engineering

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Guide RNA Preparation
  • Alternate Protocol 1: sgRNA Cloning Using Fusion PCR (Alternative Method)
  • Basic Protocol 2: Preparation of Repair Template for HR
  • Basic Protocol 3: Injecting Animals
  • Basic Protocol 4: Screening for Transgenic Worms
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Guide RNA Preparation

  Materials
  • sgRNA_top: 5′‐ATTGCAAATCTAAATGTTT N19/N20 GTTTTAGAGCTAGAAATAGC‐3′ (synthesized by DNA synthesis service)
  • sgRNA bottom: 5′‐GCTATTTCTAGCTCTAAAAC N19/N20 reverse complement AAACATTTAGATTTGCAAT‐3′ (synthesized by DNA synthesis service)
  • pHKMC1 empty sgRNA (Addgene, cat. no. 67720)
  • Plasmid miniprep kit (GeneJet, cat. no. K0502 or Qiagen, cat. no. 27104)
  • Nuclease‐free water (Qiagen, cat. no. 129114, or equivalent)
  • BamHI (NEB R0136S)
  • NotI (NEB R0189S)
  • Gel DNA Extraction Kit (Zymoclean, cat. no. D4001)
  • 2× Gibson assembly Master Mix (NEB, cat. no. E2611S)
  • Chemically competent E. coli cells (NEB, cat. no. C2987I, or equivalent)
  • LB plates containing 100 μg/ml ampicillin
  • M13F: 5′‐GTAAAACGACGGCCAGT‐3′
  • M13R: 5′‐AACAGCTATGACCATG‐3′
  • PCR thermal cycler (BioRad T100 or equivalent)
  • Heat block (VWR Scientific standard heat block, or equivalent)
  • Sterile pipet tips or toothpicks for picking colonies
  • PCR thermal cycler (BioRad T100 or equivalent)
  • Sequence analysis software (e.g., NCBI BLAST, UCSC Genome Browser, BLAT, LaserGene)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, ), transformation of E. coli (unit 1.8; Seidman et al., ), and DNA sequencing (Chapter 7)

Alternate Protocol 1: sgRNA Cloning Using Fusion PCR (Alternative Method)

  Additional Materials (also see protocol 1)
  • P1: 5′‐CGGGAATTCCTCCAAGAACTCGTACAAAAATGCTCT‐3′ (synthesized by DNA synthesis service)
  • P2: 5′‐ (N19/20‐RC) + AAACATTTAGATTTGCAATTCAATTATATAG‐3′ (where N19/20‐RC is the reverse complementary sequence of the N19/20 target sequence used in primer P3; synthesized by DNA synthesis service)
  • P3: 5′‐ (N19/20) + GTTTTAGAGCTAGAAATAGCAAGTTA‐3′ (where N19/20 represents the sgRNA target sequence; synthesized by DNA synthesis service)
  • P4: 5′‐ CGGAAGCTTCACAGCCGACTATGTTTGGCGT‐3′ (synthesized by DNA synthesis service)
  • High Fidelity Phusion DNA polymerase (NEB M0530S or equivalent) and 5× HF buffer
  • 10 mM dNTP mix (10 mM each dNTP)
  • PCR purification kit
  • EcoRI (NEB, cat. no. R0101S)
  • HindIII (NEB, cat. no. R0104S)
  • T4 DNA ligase (NEB, cat. no. M0202S) and 10× buffer
  • Additional reagents and equipment for PCR (unit 15.1; Kramer and Coen, ) and agarose gel electrophoresis (unit 2.5; Voytas, )

Basic Protocol 2: Preparation of Repair Template for HR

  Materials
  • UP‐F: 5′‐ACGGCCAGTGAATTCGAGCTCGGTA + ∼N18‐24‐3′ (N18‐24 from upstream of a gene of interest)
  • UP‐R: 5′‐GTGAAAAGTTCTTCTCCTTTACTCAT + ∼N18‐24 (RC)‐3′ (N18‐24 from upstream of a gene of interest) (reverse complement)
  • DN‐F: 5′‐TGGCATGGACGAACTATACAAA + ∼N18‐24 −3′ (N18‐24 from stop codon of a gene of interest)
  • DN‐R: 5′‐ACGCCAAGCTTGCATGCCTGCAGG + ∼N18‐24 (RC)‐3′ (N18‐24 from downstream of a gene of interest) (reverse complement)
  • GFP‐F: 5′‐ATGAGTAAAGGAGAAGAACT‐3′
  • GFP‐R: 5′‐TTTGTATAGTTCGTCCATGC‐3′
  • 10 mM dNTP mix (10 mM each dNTP)
  • High Fidelity Phusion DNA polymerase (NEB M0530S or equivalent) and 5× HF buffer
  • pPV477 (Addgene, plasmid no. 42930)
  • pUC19 (NEB, cat. no. N3041S)
  • Nuclease‐free water (Qiagen 129114 or equivalent)
  • KpnI (NEB, cat. no. R0142S)
  • SalI (NEB, cat. no. R0138S)
  • Gel DNA Extraction Kit (Zymoclean, cat. no. D4001)
  • Gibson assembly Master Mix (NEB, cat. no. E2611S)
  • Plasmid Miniprep Kit (GeneJet, cat. no. K0502 or Qiagen, cat. no. 27104)
  • LB agar plates containing 100 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • LB liquid medium containing 100 μg/ml ampicillin (unit 1.1; Elbing and Brent, )
  • M13F: 5′‐GTAAAACGACGGCCAGT‐3′
  • M13R: 5′‐AACAGCTATGACCATG‐3′
  • PCR thermal cycler (BioRad T100 or equivalent)
  • Additional reagents and equipment for PCR (unit 15.1; Kramer and Coen, ), agarose gel electrophoresis (unit 2.5; Voytas, ), and sequencing (Chapter 7)

Basic Protocol 3: Injecting Animals

  Materials
  • General purpose agarose (Bioexpress, cat. no. E‐3119‐500BX)
  • Plasmids (good‐quality DNA is required for efficient CRISPR‐Cas9 genome editing; use a Qiagen midiprep kit or equivalent for plasmid extraction):
    • Cas9 expression plasmid (Addgene, plasmid no. 46168)
    • pCFJ90 ‐ Pmyo‐2::mCherry::unc‐54utr (Addgene, plasmid no. 19327)
    • pCFJ104 ‐ Pmyo‐3::mCherry::unc‐54 (Addgene, plasmid no. 19328)
    • pMA122 ‐ peel‐1 negative selection (Addgene, plasmid no. 34873; optional)
  • N2 C. elegans wild‐type worms for injection (http://www.cgc.cbs.umn.edu/)
  • Recovery solution (M9 buffer with 4% glucose)
  • Halocarbon oil (Sigma, cat. no. H8898)
  • E. coli OP50 for seeding nematode growth medium plate (http://www.cgc.cbs.umn.edu/)
  • Nematode growth medium (NGM; Stiernagle, ; http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html) in 6‐cm Petri plates
  • Microwave oven
  • 24 × 40 mm glass coverslips (VWR, cat. no. 470145‐746, or equivalent)
  • 22 × 22 mm coverslips (VWR, cat. no. 48366‐227)
  • Microloaders (Eppendorf, cat. no. 930001007)
  • Sutter P‐97 needle puller or equivalent
  • Glass microscope slides
  • Microinjection apparatus
  • 25°C incubator (PRECISION 815 or equivalent)

Basic Protocol 4: Screening for Transgenic Worms

  Materials
  • Injected worms for analysis ( protocol 4)
  • E. coli OP50‐seeded nematode growth medium (NGM) plates (http://www.cgc.cbs.umn.edu/)
  • Worm lysis buffer (see recipe)
  • 10 mM dNTP mix (10 mM each dNTP)
  • Primers
  • High Fidelity Phusion DNA polymerase (NEB M0530S or equivalent) and 5× HF buffer
  • N2 C. elegans wild type worms for injection (http://www.cgc.cbs.umn.edu/)
  • Fluorescence stereomicroscope
  • PCR tubes
  • Heat block (VWR Scientific Standard Heat Block or equivalent)
  • 25°C incubator
  • PCR thermal cycler (BioRad T100 or equivalent)
  • Additional reagents and equipment for PCR (unit 15.1; Kramer and Coen, ) and DNA sequencing (Chapter 7)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Arribere, J.A., Bell, R.T., Fu, B.X., Artiles, K.L., Hartman, P.S., and Fire, A.Z. 2014. Efficient marker‐free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198:837‐846. doi: 10.1534/genetics.114.169730.
  Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S., Romero, D.A., and Horvath, P. 2007. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709‐1712. doi: 10.1126/science.1138140.
  Deltcheva, E., Chylinski, K., Sharma, C.M., Gonzales, K., Chao, Y., Pirzada, Z.A., Eckert, M.R., Vogel, J., and Charpentier, E. 2011. CRISPR RNA maturation by trans‐encoded small RNA and host factor RNase III. Nature 471:602‐607. doi: 10.1038/nature09886.
  Dickinson, D.J., Ward, J.D., Reiner, D.J., and Goldstein, B. 2013. Engineering the Caenorhabditis elegans genome using Cas9‐triggered homologous recombination. Nat. Methods 10:1028‐1034. doi: 10.1038/nmeth.2641.
  Dickinson, D.J., Pani, A.M., Heppert, J.K., Higgins, C.D., and Goldstein, B. 2015. Streamlined genome engineering with a self‐excising drug selection cassette. Genetics 200:1035‐1049. doi: 10.1534/genetics.115.178335.
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1‐1.1.7.
  Farboud, B. and Meyer, B.J. 2015. Dramatic enhancement of genome editing by CRISPR/Cas9 through improved guide RNA design. Genetics 199:959‐971. doi: 10.1534/genetics.115.175166.
  Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., and Calarco, J.A. 2013. Heritable genome editing in C. elegans via a CRISPR‐Cas9 system. Nat. Methods 10:741‐743. doi: 10.1038/nmeth.2532.
  Frokjaer‐Jensen, C., Davis, M.W., Ailion, M., and Jorgensen, E.M. 2012. Improved Mos1‐mediated transgenesis in C. elegans. Nat. Methods 9:117‐118. doi: 10.1038/nmeth.1865.
  Garneau, J.E., Dupuis, M.E., Villion, M., Romero, D.A., Barrangou, R., Boyaval, P., Fremaux, C., Horvath, P., Magadan, A.H., and Moineau, S. 2010. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67‐71. doi: 10.1038/nature09523.
  He, F. 2011. Single Worm PCR. Bio. Protoc. e60. Available at http://www.bio‐protocol.org/e60.
  Horvath, P. and Barrangou, R. 2010. CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167‐170. doi: 10.1126/science.1179555.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821. doi: 10.1126/science.1225829.
  Kim, H.M. and Colaiacovo, M.P. 2015a. DNA damage sensitivity assays in Caenorhabditis elegans. Bio. Protoc. 5:e1487.
  Kim, H.M. and Colaiacovo, M.P. 2015b. New insights into the post‐translational regulation of DNA damage response and double‐strand break repair in Caenorhabditis elegans. Genetics 200:495‐504. doi: 10.1534/genetics.115.175661.
  Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte, D., Jr., Shirayama, M., and Mello, C.C. 2014. A co‐CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197:1069‐1080. doi: 10.1534/genetics.114.166389.
  Kramer, M. F. and Coen, D. M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013. RNA‐guided human genome engineering via Cas9. Science 339:823‐826. doi: 10.1126/science.1232033.
  Norris, A.D., Kim, H.M., Colaiacovo, M.P., and Calarco, J.A. 2015a. Efficient genome editing in Caenorhabditis elegans with a toolkit of dual‐marker selection cassettes. Genetics 201:449‐458. doi: 10.1534/genetics.115.180679.
  Norris, A.D., Kim, H.M., Colaiacovo, M.P., and Calarco, J.A. 2015b. Efficient genome editing in Caenorhabditis elegans with a toolkit of dual marker selection cassettes. Genetics 201:449‐458. doi: 10.1534/genetics.115.180679.
  Paix, A., Wang, Y., Smith, H.E., Lee, C.Y., Calidas, D., Lu, T., Smith, J., Schmidt, H., Krause, M.W., and Seydoux, G. 2014. Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 198:1347‐1356. doi: 10.1534/genetics.114.170423.
  Seidman, C. E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Stiernagle, T. 2006. Maintenance of C. elegans. In WormBook (The C. elegans Research Community, ed.). http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html.
  Tzur, Y.B., Friedland, A.E., Nadarajan, S., Church, G.M., Calarco, J.A., and Colaiacovo, M.P. 2013. Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR‐Cas9 system. Genetics 195:1181‐1185. doi: 10.1534/genetics.113.156075.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Ward, J.D. 2015. Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co‐conversion and inactivation of NHEJ repair. Genetics 199:363‐377. doi: 10.1534/genetics.114.172361.
  Williams, B.D., Schrank, B., Huynh, C., Shownkeen, R., and Waterston, R.H. 1992. A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence‐tagged sites. Genetics 131:609‐624.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library