Scarless Cas9 Assisted Recombineering (no‐SCAR) in Escherichia coli, an Easy‐to‐Use System for Genome Editing

Christopher R. Reisch1, Kristala L.J. Prather2

1 Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida, 2 Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.8
DOI:  10.1002/cpmb.29
Online Posting Date:  January, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The discovery and development of genome editing systems that leverage the site‐specific DNA endonuclease system CRISPR/Cas9 has fundamentally changed the ease and speed of genome editing in many organisms. In eukaryotes, the CRISPR/Cas9 system utilizes a “guide” RNA to enable the Cas9 nuclease to make a double‐strand break at a particular genome locus, which is repaired by non‐homologous end joining (NHEJ) repair enzymes, often generating random mutations in the process. A specific alteration of the target genome can also be generated by supplying a DNA template in vivo with a desired mutation, which is incorporated by homology‐directed repair. However, E. coli lacks robust systems for double‐strand break repair. Thus, in contrast to eukaryotes, targeting E. coli chromosomal DNA with Cas9 causes cell death. However, Cas9‐mediated killing of bacteria can be exploited to select against cells with a specified genotype within a mixed population. In combination with the well described λ‐Red system for recombination in E. coli, we created a highly efficient system for marker‐free and scarless genome editing. © 2017 by John Wiley & Sons, Inc.

Keywords: CRISPR/Cas9; Escherichia coli; genome editing; gene deletions; λ‐Red; metabolic engineering

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Design of Donor DNA for Recombineering
  • Alternate Protocol 1: Design of Double‐Stranded DNA (dsDNA) for Recombineering
  • Basic Protocol 2: Identification and Design of sgRNA Targets
  • Alternate Protocol 2: sgRNA Target Identification Using DNA2.0
  • Basic Protocol 3: Target Cloning by Circular Polymerase Extension Cloning (CPEC)
  • Alternate Protocol 3: Round‐the‐Horn Cloning
  • Basic Protocol 4: Recombineering and Cas9 Counterselection in E. coli
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Design of Donor DNA for Recombineering

  Materials
  • DNA sequence of target regions
  • DNA editing program: “A plasmid Editor” (http://biologylabs.utah.edu/jorgensen/wayned/ape/) and Benchling (https://benchling.com) are two free and easy‐to‐use programs for DNA editing

Alternate Protocol 1: Design of Double‐Stranded DNA (dsDNA) for Recombineering

  Materials
  • DNA sequence of targeted regions
  • DNA viewing program (e.g., “A plasmid editor” or Benchling; see protocol 1) and Internet access
  • High‐fidelity DNA polymerase
  • Additional materials and reagents for PCR amplification (unit 15.1; Kramer and Coen, ) and purification of DNA (unit 2.1; Moore and Dowhan, ).

Basic Protocol 2: Identification and Design of sgRNA Targets

  Materials
  • Wild‐type and mutant DNA sequences obtained in protocol 1
  • DNA viewing program (e.g., “A plasmid editor” or Benchling; see protocol 1) and Internet access

Alternate Protocol 2: sgRNA Target Identification Using DNA2.0

  Materials
  • Wild‐type and mutant DNA sequences obtained in protocol 1
  • DNA viewing program (e.g., “A plasmid editor” or Benchling; see protocol 1) and Internet access

Basic Protocol 3: Target Cloning by Circular Polymerase Extension Cloning (CPEC)

  Materials
  • Primer CPEC2F: cggcgtcacactttgctat
  • Primer gamR: tttataacctccttagagctcga
  • Target‐specific primers: sgRNA‐target‐F and sgRNA‐target‐R ( protocol 3
  • pKDsgRNA‐xxx (Addgene, cat. no. 62654 or 62656) for PCR template
  • High‐fidelity DNA polymerase (Q5 or Phusion polymerase; New England Biolabs)
  • DpnI restriction enzyme
  • Competent E. coli for cloning (unit 1.8; Seidman et al., )
  • Super Optimal Broth with catabolite repression (SOC; unit 1.8; Seidman et al., )
  • LB broth and agar plates with 50 mg/liter spectinomycin (unit 1.1; Elbing and Brent, )
  • 2× OneTaq master mix (New England Biolabs)Primer pKDseq5: cagtgaatgggggtaaatgg
  • Primer sgrnaR: gcctgcagtctagactcgag
  • Primer sgrnaA: agctttcgctaaggatgattt
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, ), purification of DNA from agarose gels (unit 2.6; Moore et al., ), PCR amplification (unit 15.1; Kramer and Coen, ), media preparation and use of bacteriological tools (unit 1.1; Elbing and Brent, ), transformation of E. coli (unit 1.8; Seidman et al., ), and DNA sequence analysis (Chapter 7)

Alternate Protocol 3: Round‐the‐Horn Cloning

  Additional Materials (also see protocol 5)
  • Primers: sgRNA‐target‐F (see protocol 5) and PtetR (PO 4‐gtgctcagtatctctatcactga)
  • T4 DNA ligase and 10× ligase buffer
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, ), ligation of DNA fragments (unit 3.1; Struhl, ), PCR amplification (unit 15.1; Kramer and Coen, ), transformation of E. coli (unit 1.8; Seidman et al., ), and DNA sequence analysis (Chapter 7)

Basic Protocol 4: Recombineering and Cas9 Counterselection in E. coli

  Materials
  • pCas9cr4 (Addgene, cat. no. 62655)
  • E. coli host strain (e.g., MG1655)
  • LB broth and agar plates with 30 mg/liter chloramphenicol (unit 1.1; Elbing and Brent, )
  • Super Optimal Broth with catabolite repression (SOC; unit 1.8; Seidman et al., )
  • pKDsgRNA‐xxx (made in protocol 5)
  • LB agar plates with 30 mg/liter chloramphenicol and 50 mg/liter spectinomycin (unit 1.1; Elbing and Brent, )
  • LB agar plates with 30 mg/liter chloramphenicol, 50 mg/liter spectinomycin, and 100 mg/liter anhydrotetracycline (aTc)
  • Primers for DNA sequencing or allele‐specific PCR
  • SOB medium (see recipe) with 30 mg/liter chloramphenicol and 50 mg/liter spectinomycin
  • 20% (w/v) L‐arabinose, sterile
  • Glycerol‐mannitol solution: 20% (v/v) glycerol/1.5% (w/v) mannitol solution, sterile (chilled)
  • LB broth and agar plates (no antibiotics; unit 1.8; Seidman et al., )
  • Oligonucleotides or dsDNA donor (see protocol 1)
  • Anhydrotetracycline (aTc)
  • LB agar plates containing 50 mg/liter spectinomycin and 100 µg/liter aTc (unit 1.8; Seidman et al., )
  • pKDsgRNA‐p15a (Addgene, cat. no. 62656)
  • Electroporation cuvettes
  • Electroporator
  • Centrifuge
  • Spectrophotometer
  • Additional reagents and equipment for transformation of E. coli (unit 1.8; Seidman et al., ), miniprep of plasmid DNA (unit 1.6; Engebrecht et al., 1991), and DNA sequence analysis (Chapter 7) or allele‐specific PCR (Little, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bae, S., Park, J., and Kim, J.‐S. 2014. Cas‐OFFinder: A fast and versatile algorithm that searches for potential off‐target sites of Cas9 RNA‐guided endonucleases. Bioinformatics 30:1473‐1475. doi: 10.1093/bioinformatics/btu048.
  Bonde, M.T., Klausen, M.S., Anderson, M.V., Wallin, A.I.N., Wang, H.H., and Sommer, M.O.A. 2014. MODEST: A web‐based design tool for oligonucleotide‐mediated genome engineering and recombineering. Nucleic Acids Res. 42:W408‐W415. doi: 10.1093/nar/gku428.
  Costantino, N. and Court, D.L. 2003. Enhanced levels of λ Red‐mediated recombinants in mismatch repair mutants. Proc. Natl. Acad Sci. U.S.A. 100:15748‐15753. doi: 10.1073/pnas.2434959100.
  Cui, L. and Bikard, D. 2016. Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic Acids Res. 19:4243‐4251. doi: 10.1093/nar/gkw223.
  Datsenko, K.A. and Wanner, B.L. 2000. One‐step inactivation of chromosomal genes in Escherichia coli K‐12 using PCR products. Proc. Natl. Acad Sci. 97:6640‐6645. doi: 10.1073/pnas.120163297.
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 59:1.1.1‐1.1.7.
  Ellis, H.M., Yu, D., DiTizio, T., and Court, D.L. 2001. High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single‐stranded oligonucleotides. Proc. Natl. Acad Sci. 98:6742‐6746. doi: 10.1073/pnas.121164898.
  Huang, M.M., Arnheim, N., and Goodman, M.F. 1992. Extension of base mispairs by Taq DNA polymerase: Implications for single nucleotide discrimination in PCR. Nucleic Acids Res. 20:4567‐4573. doi: 10.1093/nar/20.17.4567.
  Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L. A. 2013. CRISPR‐assisted editing of bacterial genomes. Nat. Biotechnol. 31:233‐239. doi: 10.1038/nbt.2508.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821. doi: 1.1126/science.1225829.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and oiptimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Little, S. 1995. Amplification‐refractory mutation system (ARMS) analysis of point mutations. Curr. Protoc. Hum. Genet. 7:9.8.1‐9.8.12.
  Luo, M.L., Leenay, R.T., and Beisel, C.L. 2016. Current and future prospects for CRISPR‐based tools in bacteria. Biotechnol. Bioeng. 113:930‐943. doi: 10.1002/bit.25851.
  Malina, A., Cameron, C.J.F., Robert, F., Blanchette, M., Dostie, J., and Pelletier, J. 2015. PAM multiplicity marks genomic target sites as inhibitory to CRISPR‐Cas9 editing. Nat. Commun. 6. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4686818/ [Accessed June 24, 2016]. doi: 10.1038/ncomms10124.
  Maresca, M., Erler, A., Fu, J., Friedrich, A., Zhang, Y., and Stewart, A.F. 2010. Single‐stranded heteroduplex intermediates in λ Red homologous recombination. BMC Mol. Biol. 11:54. doi: 10.1186/1471‐2199‐11‐54.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
  Moore, D., Dowhan, D., Chory, J. and Ribaudo, R.K. 2002. Isolation and purification of large DNA restriction fragments from agarose gels. Curr. Protoc. Mol. Biol. 59:2.6.1‐2.6.12.
  Mosberg, J.A., Lajoie, M.J., and Church, G.M. 2010. Lambda Red recombineering in Escherichia coli occurs through a fully single‐stranded intermediate. Genetics 186:791‐799. doi: 10.1534/genetics.110.120782.
  Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C., and Markham, A.F. 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17:2503‐2516. doi: 10.1093/nar/17.7.2503.
  Ochman, H., Gerber, A.S., and Hartl, D.L. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621‐623.
  Pyne, M.E., Moo‐Young, M., Chung, D.A., and Chou, C.P. 2015. Coupling the CRISPR/Cas9 system to lambda Red recombineering enables simplified chromosomal gene replacement in Escherichia coli. Appl. Environ. Microbiol. 81:5103‐5114.
  Quan, J. and Tian, J. 2011. Circular polymerase extension cloning for high‐throughput cloning of complex and combinatorial DNA libraries. Nat. Protoc. 6:242‐251. doi: 10.1038/nprot.2010.181.
  Quintin, M., Ma, N.J., Ahmed, S., Bhatia, S., Lewis, A., Isaacs, F.J., and Densmore, D. 2016. Merlin: Computer‐aided oligonucleotide design for large scale genome engineering with MAGE. ACS Synth. Biol. 5:452‐458. doi: 10.1021/acssynbio.5b00219.
  Raman, S., Rogers, J.K., Taylor, N.D., and Church, G.M. 2014. Evolution‐guided optimization of biosynthetic pathways. Proc. Natl. Acad. Sci. 111:17803‐17808. doi: 10.1073/pnas.1409523111.
  Reisch, C.R. and Prather, K.L.J. 2015. The no‐SCAR (Scarless Cas9 Assisted Recombineering) system for genome editing in Escherichia coli. Sci. Rep. 5:15096. doi: 10.1038/srep15096.
  Sawitzke, J.A., Costantino, N., Li, X.‐T., Thomason, L.C., Bubunenko, M., Court, C., and Court, D.L. 2011. Probing cellular processes with oligo‐mediated recombination and using the knowledge gained to optimize recombineering. J. Mol. Biol. 407:45‐59. doi: 10.1016/j.jmb.2011.01.030.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Struhl, K. 1987. Subcloning of DNA fragments. Curr. Protoc. Mol. Biol. 13:3.16.1‐3.16.2.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, H.H. and Church, G.M. 2011. Multiplexed genome engineering and genotyping methods applications for synthetic biology and metabolic engineering. Meth. Enzymol. 498:409‐426. doi: 10.1016/B978‐0‐12‐385120‐8.00018‐8.
  Wang, T., Wei, J.J., Sabatini, D.M., and Lander, E.S. 2014. Genetic screens in human cells using the CRISPR‐Cas9 system. Science 343:80‐84. doi: 10.1126/science.1246981.
  Wang, H.H., Isaacs, F.J., Carr, P.A., Sun, Z.Z., Xu, G., Forest, C.R., and Church, G.M. 2009. Programming cells by multiplex genome engineering and accelerated evolution. Nature 460:894‐898. doi: 10.1038/nature08187.
  Warren, D.J. 2011. Preparation of highly efficient electrocompetent Escherichia coli using glycerol/mannitol density step centrifugation. Anal. Biochem. 413:206‐207. doi: 10.1016/j.ab.2011.02.036.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library