Production of Purified CasRNPs for Efficacious Genome Editing

Emily Lingeman1, Chris Jeans2, Jacob E. Corn1

1 Innovative Genomics Institute, University of California, Berkeley, California, 2 QB3 MacroLab, University of California, Berkeley, California
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.10
DOI:  10.1002/cpmb.43
Online Posting Date:  October, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

CRISPR‐Cas systems have been harnessed as modular genome editing reagents for functional genomics and show promise to cure genetic diseases. Directed by a guide RNA, a Cas effector introduces a double stranded break in DNA and host cell DNA repair leads to the introduction of errors (e.g., to knockout a gene) or a programmed change. Introduction of a Cas effector and guide RNA as a purified Cas ribonucleoprotein complex (CasRNP) has recently emerged as a powerful approach to alter cell types and organisms. Not only does CasRNP editing exhibit increased efficacy and specificity, it avoids optimization and iteration of species‐specific factors such as codon usage, promoters, and terminators. CasRNP editing has been rapidly adopted for research use in many contexts and is quickly becoming a popular method to edit primary cells for therapeutic application. This article describes how to make a Cas9 RNP and outlines its use for gene editing in human cells. © 2017 by John Wiley & Sons, Inc.

Keywords: Cas9; genome editing; ribonucleoprotein; RNP; CRISPR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Cas9 Protein Bacterial Expression
  • Basic Protocol 2: Cas9 Purification
  • Basic Protocol 3: gRNA Template Assembly, Amplification, and In Vitro Transcription
  • Basic Protocol 4: gRNA Purification With Magnetic SPRI Beads
  • Alternate Protocol 1: gRNA Purification with RNeasy Spin Columns
  • Support Protocol 1: Production of SPRI Beads and Testing
  • Basic Protocol 5: CasRNP Complex Formation and Electroporation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cas9 Protein Bacterial Expression

  Materials
  • Rosetta2(DE3)pLysS competent cells (Novagen, cat. no. 71403)
  • Ice
  • Cas9 expression plasmid: pMJ915, Addgene, plasmid #69090
  • 2×YT liquid medium (without antibiotics)
  • LB‐agar plate containing 100 μg/ml carbenicillin and 33 μg/ml chloramphenicol
  • Sterile glass beads (3 mm)
  • 10% bleach
  • 2×YT liquid media containing 100 μg/ml carbenicillin and 33 μg/ml chloramphenicol.
  • Isopropyl β‐D‐1‐thiogalactopyranoside (IPTG; 1 M in water)
  • Pepstatin A (1 mg/ml in methanol)
  • Leupeptin (1 mg/ml in water)
  • Phenylmethylsulfonyl fluoride (PMSF, 100 mM in 95% ethanol)
  • Nickel Buffer A (ice‐cold, see recipe)
  • Heated water bath (42°C)
  • Incubator (37°C) with rotating platform
  • Sterile pipette tips or toothpicks
  • 250‐ml and 2.5‐liters baffled culture flasks (e.g., Thompson Instrument Company, cat. nos. 931144 and 931136‐B)
  • Refrigerated shaking incubator (e.g., Certomat BS‐1)
  • 25‐ml serological pipette
  • Cell density meter (e.g., GE Lifesciences Ultrospec 10) or UV‐vis spectrometer
  • Centrifuge for 1‐liter bottles (Beckman Coulter Avanti J26‐XP) and 1‐liter bottles (Beckman Coulter, cat. no. 363676)

Basic Protocol 2: Cas9 Purification

  Materials
  • Cells (from protocol 1)
  • Nickel buffers A and B, Ion‐Exchange Buffers A and B, and Size‐Exclusion Buffer (see reciperecipes)
  • TEV protease (e.g., SelecTEV Protease, Lucigen Corp., cat. no. 30810‐1)
  • 1 M Dithiothreitol (DTT, in water)
  • 0.5 M NaOH
  • Milli‐Q water
  • Liquid nitrogen
  • Sonicator (Sonics VCX 500)
  • Centrifuge and rotor for 30‐ to 40‐ml tubes and up to 30000 × g (e.g., Sorval RC 5C plus, with SS34 rotor)
  • Chromatography columns: all from GE Life Sciences:
    • 5 ml HisTrap FF Crude (17‐5286‐01 pack of 5)
    • HiPrep 26/10 Desalting (17‐5087‐01)
    • 5 ml HiTrap SP HP (17‐1152‐01 pack of 5)
    • Sephacryl S‐300 HR 16/60 (17‐1167‐01)
  • UV/vis spectrometer (e.g., GE Life Sciences NanoVue)
  • Centrifugal concentration units, 10 kDa MWCO (e.g., Millipore, cat. no. UFC901024)
  • 10‐ml and 20‐ml sterile syringes and syringe filters (0.2 μm)
  • FPLC system with gradient‐making capability and fractionation system, with flow rates up to 10 ml/min (e.g., GE Life Sciences AKTA series)
  • Tubes or 96‐well plates for fractionation
  • 1.7‐ml microcentrifuge tubes, certified DNase/RNase‐free

Basic Protocol 3: gRNA Template Assembly, Amplification, and In Vitro Transcription

  Materials
  • T7FwdVar oligo (5′‐GGATCCTAATACGACTCACTATAG–protospacer sequence—GTTTTAGAGCTAGAA‐3′)
  • 10 mM dNTPs
  • DEPC‐treated water
  • 5× Phusion HF Buffer
  • RNase Away
  • T7RevLong oligo (5′‐AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGG ACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC‐3′)
  • T7FwdAmp primer (5′‐GGATCCTAATACGACTCACTATAG‐3′)
  • T7RevAmp primer (5′‐AAAAAAGCACCGACTCGG‐3′)
  • Phusion HF DNA Polymerase
  • Agarose
  • TAE buffer
  • NEB HiScribe T7 High Yield RNA synthesis kit (NEB, cat. no. E2040S) containing:
    • T7 RNA Polymerase Mix
  • RNase‐free DNase
  • Calf intestinal alkaline phosphatase (CIP; NEB, cat. no. M0290)
  • Thermal cycler
  • Agarose gel rig and power source
  • 37°C incubator

Basic Protocol 4: gRNA Purification With Magnetic SPRI Beads

  Materials
  • SPRI‐beads (see the Support Protocol)
  • IVT reaction (see protocol 4)
  • 80% Ethanol
  • Agarose
  • 10% polyacrylamide TBE‐urea gel
  • Ethanol
  • Pipettes
  • Magnetic stand
  • Qubit or spectrophotometer
  • Polyacrylamide gel rig and power source

Alternate Protocol 1: gRNA Purification with RNeasy Spin Columns

  Materials
  • IVT Reaction (see protocol 4)
  • Qiagen RNeasy kit containing:
    • RLT Buffer
    • RPE Buffer
    • RNeasy mini spin column
  • 100% ethanol
  • DEPC‐treated water
  • 10% polyacrylamide TBE‐urea gel
  • Benchtop centrifuge
  • 1.5‐ml microcentrifuge

Support Protocol 1: Production of SPRI Beads and Testing

  Materials
  • 0.5 M EDTA, pH 8.0 (Amresco, cat. no. E177)
  • 1.0 M Tris, pH 8.0 (Amresco, cat. no. E199)
  • Sera‐mag SpeedBeads (Fisher, cat. no. 09‐981‐123)
  • PEG‐8000 (Amresco, cat. no. 0159)
  • 5 M NaCl (Amresco, cat. no. E529)
  • Tween 20 (Amresco, cat. no. 0777)
  • Nuclease‐free water (Amresco, cat. no. E476)
  • Fermentas ladder(s) (Ultra‐low range: Fisher, cat. no. FERSM1211, 50 bp: cat. no. FERSM0371)
  • Ethanol (EtOH)
  • Loading dye (Thermo Fisher, cat. no. R0611)
  • Agarose
  • TAE
  • 50‐ml conical tubes
  • 1.5‐ml microtube
  • Rare‐earth magnet stand (e.g., Ambion, cat. no. AM10055 or NEB, cat. no. S1506S)
  • 200‐μl or 1000‐μl pipettors
  • Aluminum foil
  • Agarose gel rig and power source

Basic Protocol 5: CasRNP Complex Formation and Electroporation

  Materials
  • Purified Cas9 protein (see protocol 2)
  • Cas9 buffer (see recipe)
  • Purified gRNA ( protocol 5)
  • Single‐stranded DNA (Richardson et al., ; Richardson, Ray, Bray, & Corn, )
  • HEK293Ts or cell line of your choice
  • Trypsin
  • Cell culture medium appropriate for HEK293Ts:
  • DMEM (Thermo Fisher, cat. no. 10566016)
  • 10% Fetal bovine serum (FBS; Seradigm, cat. no. 1500‐500)
  • Nucleofector solution
  • Pipettes and pipette tips
  • Hemacytometer
  • 15‐ml conical tubes
  • Centrifuge
  • 12‐well tissue culture plates
  • Lonza nucleofection cuvetter and solution for your cell type
  • 4D Lonza Nucleofector
  • 200‐μl pipette
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aida, T., Chiyo, K., Usami, T., Ishikubo, H., Imahashi, R., Wada, Y., … Tanaka, K. (2015). Cloning‐free CRISPR/Cas system facilitates functional cassette knock‐in in mice. Genome Biology, 16(1), 87. doi: 10.1186/s13059‐015‐0653‐x.
  Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S., … Horvath, P. (2007). CRISPR provides acquired resistance against viruses in prokaryotes. Science, 315(March), 1709–1712. doi: 10.1126/science.1138140.
  Burger, A., Lindsay, H., Felker, A., Hess, C., Anders, C., Chiavacci, E., … Mosimann, C. (2016). Maximizing mutagenesis with solubilized CRISPR‐Cas9 ribonucleoprotein complexes. Development, 143(11), 2025–2037. doi: 10.1242/dev.134809.
  Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., & He, L. (2016). Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry, 291(28), 14457–14467. doi: 10.1074/jbc.M116.733154.
  Cho, S. W., Lee, J., Carroll, D., Kim, J. S., & Lee, J. (2013). Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9‐sgRNA ribonucleoproteins. Genetics, 195(3), 1177–1180. doi: 10.1534/genetics.113.155853.
  Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., … Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science (New York, N.Y.), 339(6121), 819–823. doi: 10.1126/science.1231143.
  Deltcheva, E., Chylinski, K., Sharma, C. M., Gonzales, K., Chao, Y., Pirzada, Z. A., … Charpentier, E. (2011). CRISPR RNA maturation by trans‐encoded small RNA and host factor RNase III. Nature, 471(7340), 602–607. doi: 10.1038/nature09886.
  Faircloth, B., & Glenn, T. (2014). Protocol: Preparation of an AMPure XP substitute (AKA Serapure). Retrieved from https://doi.org/doi:10.6079/J9MW2F26
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual‐RNA – guided DNA endonuclease in adaptive bacterial immunity. Science, 337(August), 816–822. doi: 10.1126/science.1225829.
  Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., & Doudna, J. (2013). RNA‐programmed genome editing in human cells. eLife, 2, e00471. doi: 10.7554/eLife.00471.
  Kim, S., Kim, D., Cho, S. W., Kim, J., & Kim, J.‐S. (2014). Highly efficient RNA‐guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research, 128, 1–32. https://doi.org/10.1101/gr.171322.113.Freely
  Kouranova, E., Forbes, K., Zhao, G., Warren, J., Bartels, A., Wu, Y., & Cui, X. (2016). CRISPRs for optimal targeting: Delivery of CRISPR components as DNA, RNA, and protein into cultured cells and single‐cell embryos. Human Gene Therapy, 27(6), 464–475. doi: 10.1089/hum.2016.009.
  Lin, S., Staahl, B. T., Alla, R. K., & Doudna, J. A. (2014). Enhanced homology‐directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. eLife, 3, e04766. doi: 10.7554/eLife.04766.
  Makarova, K. S., Grishin, N. V., Shabalina, S. a, Wolf, Y. I., & Koonin, E. V. (2006). A putative RNA‐interference‐based immune system in prokaryotes: Computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biology Direct, 1(1), 7. doi: 10.1186/1745‐6150‐1‐7.
  Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., … Church, G. M. (2013). RNA‐guided human genome engineering via Cas9. Science (New York, N.Y.), 339(6121), 823–826. doi: 10.1126/science.1232033.
  Marraffini, L. A., & Sontheimer, E. J. (2008). CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science, 322(5909), 1843–1845. doi: 10.1126/science.1165771.
  Richardson, C. D., Ray, G. J., Bray, N. L., & Corn, J. E. (2016a). Non‐homologous DNA increases gene disruption efficiency by altering DNA repair outcomes author list. Nature Communications, 7(12463), 1–7. https://doi.org/10.1101/040212
  Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., & Corn, J. E. (2016b). Enhancing homology‐directed genome editing by catalytically active and inactive CRISPR‐Cas9 using asymmetric donor DNA. Nature Biotechnology, 34(3), 339–344. doi: 10.1038/nbt.3481.
  Rohland, N., & Reich, D. (2012). Cost‐effective, high‐throughput DNA sequencing. Genome Research, 22, 939–946. doi: 10.1101/gr.128124.111.
  Sung, Y., Kim, J., Kim, H., Lee, J., & Jeon, J. (2014). Highly efficient gene knockout in mice and zebrafish with RNA‐guided endonucleases. Genome Research, 24, 125–131. doi: 10.1101/gr.163394.113.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library